Description :
Non Conding Region
Location :
Scaffold_1:128853- 128978
Sequence
125 bases(100 bases per row)
TGCCAAAATGGACCAAAAAATAGTCCAACGTAAAATTCCATAGTGACATTGTCACTAAAATgaaagcaacttcaacttgaaaatggctacactttcTAAA
GTGTATCTTGCTGTATTGGTGTCAT