Description :
Non Conding Region
Location :
scaffold_1:128631- 128706
Sequence
75 bases(100 bases per row)
TCTCTCTCTTTCTCTCTTTTGGGGTATTTCCAGTTAACGTTTCGCAAGCACTCGACTCTTCACGTCGCTAACCGA