Description :
Non Conding Region
Location :
Scaffold_1:128615- 128924
Sequence
309 bases(100 bases per row)
CGGATCGCGGGACGTGGGGGGTTAGCGGACCGAGGGAACTGCCGAGCCGCATAGAGATGGCGCCGCTGCCCCGTAGAAGCCACGACCGCGCCGGTGCAGG
TCTGCGTGTGTATAAACCGAGGCGAATACGATGCATATCATCGATGATTCCCGCCCAGTGCAAGTGCTTCCGCGAGCGGAAATAGCGCGCCTGCTTGCGT
TCGGTGGTCGCAGCGATCCCTTGCTTCATTCGTTTTGTCGGACGGTGTTGCGGCACCTTTTGAACGACCCGTCGTCGTCGCGAGCGTCACATCCTGCACA
TCGCCAGCA