Description :
Non Conding Region
Location :
Scaffold_1:12861- 13731
Sequence
870 bases(100 bases per row)
GCTCCTGGGTGAGGGTACGATAACCAAGCGTCTTGTGTGTAGGTGTGTATGGGTCTGCGAGACGCTATCTCTCTCTAATCGCTTCGCCAGCGAGCGCGCT
TCCTCCTCCTTCTTCTTCGTCACGCGCGATTGTCCCAAGCTTCTTGCTTGTCTTGTGTTTGTGCGATGTTGACGGCGGGCTGCTTGTGTTTGAGTTTGAG
GGAAAAGGGAGGATTGGGGGGTAAAAGGGGCATCAATACAATATATTGCATTGCATTGCTGGGTTTTGGGTGGAGTGTTGCATTGTGGAAGTCTTGAAGC
AGTTGCGAGAAAGGGATTGGTTTTCAACGATTAGCTCTCACAGATTATTTGATTTTTGTATGCGAGCGAGCGAATCTGACGAAAATGAGCACACGTGTTG
ATGAAGCTTCAGCGGCCTGTGCATGCATGTCCACTGGACGGACAGCACTGCTTGAAACGAAATCGCTTCTGGTATCAGTCATGAGGGATGGTCGAATGGA
AAATCGAGCATACACAACTCAGCACGGTAGTCCCGACAGCTGAGAATCTGCGTCCCATTTCCGAACTCACGCTTCAGAGGCAACCGATGGAACGACAAAA
TGGAGGAGAGCAATGCAGTTGCTTTTTATTTCAACATTGTTGCCGTGCTCTCTCCTAAGCCGCAAGTCATCCTCACTTACTGGCTCATTTTTGTGGTGTT
GTTTGTAATATTTGTGTTGTACTTTTGCATCAAGCGCACGTGATTGCTGCCATCTCACCTGGTGCTGTTCAAGTTGAACACCAAGAGACAGCGAGCGATG
CAACGTGCGTTCGATCGATCGTGGAATAGAGAGGAAGAAACAGGGAATGAATAATACACAGAGAGAAAAT