Description :
Non Conding Region
Location :
Scaffold_1:128166- 128602
Sequence
436 bases(100 bases per row)
CCGCGACGGAATGGAAAATTGGGCGCTACGACTCGTCACCTGATAGTTTCCGCTATTATTTTCTGTCAGCTGGTTGTGGAAGTTCAAAGTTGATGAAGCA
GTGCACAGGTTATTGCAGGACGGACAAGAGATAGTACTGGAGATTGGAGGGGATCTGCATAGTGTATTATGGTCCGGCAGAAAATCCAGAAAACCTACAC
ATTTTTCCTTCGTTGGACTTTGGCTCCGTTCGTAGGACATGCGTGCCTATTGCGGTGCCGGAGGAGTGATTTGTGTAGCTGTTGGGGCGATATCGTGAAC
CCGTTGTTGGTTTTGGATGCACAAGGCGATATCACCGAAACCGGCACTTGGTGTCGACACCTTGCTTGACGAGGACTCGACGGTGAGTTGGTGACGACGT
CGCTACGATAAAGACCGGAACGCGAGAGAGCGACGA