Description :
Non Conding Region
Location :
scaffold_1:128156- 129679
Sequence
1523 bases(100 bases per row)
ATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTG
TTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGA
TCCATCTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCG
GCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGG
TTGGACCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGACATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAG
TTTTGAATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTG
GTTCGTTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGTAGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCC
ATAAAACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGC
ACAAAAGTGCAACGTTTACAAACTTCTACTCGACAACGAAACTACATGGCATGCAGTACATCTGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCA
AAACGTTTCGTTGTCCGTCGCGGCACGACTGTGAAGACCACCAACTACATCAATGTCTGTTGGCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTAC
GACCTGCCTCTATGGAAACCTTAGCTAGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTCGAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTG
GACGATCAGCAATGGTAGGTAGGGGCGTGAAACATTCATTGATTTAGTTCAGTTCACAATAAGCAACCCAGCGAGCAATACACTCATTGACCGTTATTTA
CCTAAAAAAACGTTAAATTGGTGTTCCTATCGCCATGTTGGGAATAGTACCAAAACCTTAATTCGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAAT
AGCATTCTCGTCTTCGTGACCTTGTCTGCGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGTTGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAA
TCAACACCGTATTCTCAAATAGTCTCCCCAGTCACTACAAGCCCCGCAACCCTCCGCTTAACCTCTCAAGCCTCCGCTCCTCGCTTCTCGTGCTGCTACA
CATATTGAAGCCGCAACGAACAA