Description :
Non Conding Region
Location :
Scaffold_1:128046- 128183
Sequence
137 bases(100 bases per row)
AGATCGGCGACTAGATCGGCCTACGTTCGGAGTGTGTACATCGGCAAGAAGTGTGAGTGAAAGCACGAATATAAACTCAACTTGTAGAGGAACCCTGGTA
TGAATGATGTAAGCTGCGTCTGCAAAAACTACTTGAT