Description :
Non Conding Region
Location :
Scaffold_1:127980- 128213
Sequence
233 bases(100 bases per row)
AAGTTGTTTAATGATTTACGTTCTTGCAATTTGTGTCTCCATTTTTGCCCGTTTGCGCTACTCATTGATTCCATGAGACCCTCTACACACTCCCTTCCTC
CTCCACACGCGGAAATGGCGTCTAAATCCTCTAATAGCGCTTGTTTGAGTCTTTTTGATCCGGAGGCCTGAGGCAGCTGGCCTGAGACCTTTCGGTGGCG
TTAGCTTATATATAGCCCTCCGTCCGCACCCCA