Description :
Non Conding Region
Location :
contig_1:127687- 129207
Sequence
1520 bases(100 bases per row)
ATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTG
TTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGA
TCCATCTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCG
GCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGG
TTGGACCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGACATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAG
TTTTGAATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTG
GTTCGTTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGTAGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCC
ATAAAACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGC
ACAAAAGTGCAACGTTTACAAACTTCTACTCGACAACGAAACTACATGGCATGCAGTACATCTGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCA
AAACGTTTCGTTGTCCGTCGCGGCACGACTGTGAAGACCACCAACTACATCAATGTCTGTTGGCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTAC
GACCTGCCTCTATGGAAACCTTAGCTAGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTCGAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTG
GACGATCAGCAATGGTAGGTAGGGGCTGAAACATTCATTGATTTAGTTCAGTTCACAATAAGCAACCCAGCGAGCAATACACTCATTGACCGTTATTTAC
CTAAAAAACGTTAAATTGGTGTTCCTATCGCCATGTTGGGAATAGTACCAAAACCTTAATTCGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAATAG
CATTCTCGTCTTCGTGACCTTGTCTGCGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGTTGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAATC
AACACCGTATTCTCAAATAGTCTCCCCAGTCACTACAAGCCCGCAACCCTCCGCTTAACCTCTCAAGCCTCCGCTCCTCGCTTCTCGTGCTGCTACACAT
ATTGAAGCCGCAACGAACAA