Description :
Non Conding Region
Location :
Scaffold_1:127504- 129994
Sequence
2490 bases(100 bases per row)
CGATGTATCCTTGTGCCTGTCTTTTCATCAGGAACGAAATCACCGAAATAAATATGTAGTACAAGTATCAAGTTTCTTTCAATCTCGCTAGAGATAAAGC
TGGTATACTATATGTTTGTAGCACTGACAATTATTAATAAACACTTGCCATGCCCCGCCTTCCTCGCCAAAGCCTTCCTCCAACTCCATCTACGACCAGC
ATTGTCCTCTGCGTCGAGGCTTTCCTCATGCAGCATCCTCGTCCGTAGAGCTTTCTCTGCCTTGAACACGCGGGCGCTGTCGCGAGCGTTGTCGCGCCCA
CGTGCACATGCCGACCAGCGGCGCGCCAACGTATCGGCGTAGCCGAGCCAGTCGTTGTCGCAGCTCTTGGCGCCAGCAACGGACCGCGGCTCGTTGACAG
AGAGCTGCGCTACGTCGATCGCTGCGTCGAGCACACGGCGCTTTTGCCTCTGCGACCGCCGAGAGTTGTTTTACGAGCCTGTTTCTCGGTGTGAGCTTGT
CCTGGGCCAGTCTGGCACGAGCCCTGCAAGCATGAGCTCGGCGTGGCTCGCGATCATTGCGCGTGTCGGTGTCGCCGCTCACGACGGCATCGGCCTCTAG
TGCTGTGTCACATTCTGCAAACGGTCCGCGGTGCCAAGCCGCTGACAAGCGATCACGACGCGCCACCGTCAGAGCCGACAAGTGGCCAAGCCACGCCACC
GTCAGAGACGGCAAACGCGCCCGGTGACGACGTACCGGGCGCGTTTGCCGTCTCTGACAGCGGCGTGGCTTGGTCACTTGTCGGCTCTGACGGCGGCGCG
TCGTGATCGCTTGCCGGCTCGGACGTCGGCGGGCGCGAGTATAAATGAAGCAGACGTGGTATTGTTTTAATTAAATGCATTGGCCCACCACCGCGGGCCG
TTGACCCATGTATAAAAATATTCCGGTGATATAGCACGGGAAGAATCGCAGTGGTCGATGCACTGCGATCTCAGACTTCGACCAACGACGCTCGTGGTAA
TCTGATCGGTGCGGCAAGAGACACGGAAAGAAGAGAGAAGATTGGACGCGCGAGGACCAGGTCGCGGCTCGCCGGCTGCGTCATCGCCGCAGTTTCAAGT
GGCAACAGCGCGCTGCAGAATCTTGCCTCCACGTGCCTCCACGTCTTGCAGATGAGAGACAGCTGCCAGCGCCAGCTGCTGAGACGCCAAGCTTCAAGCC
ACCTGGTTGGCCACGCAGGTGTGGTCTGGGTGGCGCCTGTCGAATTTGGACTGATCACGGCGACAGTCGGCTGGAAAGGTTGAGGCCCCATTGACGGTTC
CTAGTAGTCGAGAGGCATGGGGAGGCTGGCGGTCTTGAGGTCGTCAAGTGCCACCGCACCGCGAATGGTCCGACGAGGGTTGCAGTATGGCTTGTCGACT
GCTCTGCGACGGAAGAGTGAAGCGCTCAATGACCATTCCGGATAACCGAATGTTATGCGGATGATTGCGGGGCCATAAACTGCCAGCGTCGGCAAGACCC
GAGCGACCGACGACCGAGCAGCCGGCCGCCATGGGCCACGACGCGCTGACGACGACGGACGCCGCCTGGAGCGACTGACCCGTGCTGCATGGTGAGACTG
ACCAGATGCACCTCGACGAGGCCCGCGCCAAGGAAGGCCGCGTCATCGAGTGGCCGTCAACGTCAAGCCGCTTGTGAAGGAGCGCGACTCGGTCGTGGTA
CTGGCACCACCTGCCGCGCGCGCATGATAAAGCCAAGTGCGCACCCTCAATGGCGAAGGAGCGGCGCGTCCTTCTTGCAGGGTCGTTGCCCAGCCCGTTG
TTCTACTGCATCCCGCACGCCAATGGATGCTCGGGTACGCGAATCAAGGTAGCGTGTGCTCGTGCAGTCATGATGTAGGCTCGATCGACTGCGCGATGCA
ACGTCGCTTGTCAGGAAGAAGCCTCCGACGGCAACGCTACCGTCGCGACCTCCCAGTGTCTAGCAGGCTCATATACTAGTATGTATCTTGCTTACCGTCG
AGCGGACGCCATTGTGGCGGACTGCCCGACGCCGTCGAAGCGGACGAAGCGGGCATTATCCACCGCGTAGCCTTGTACGCGGGTCTCTGCGTCGATCGTT
TTACCTCTGTCTGCCGTCATTTTGCATCTTGCCAGCGCCATCCCAAAACTGTCGTAGCAAGCGCCATGTCGAAGCAGATCTTGTTTTCGTCTCGCATTTA
TATCTCTTCTCGAATCGTATTTTCGTGTTTGAATATTGCGTTTGGTGTTGCTTCCATCTTGAATGCCACGTGTGATTCTCGTCTCTAGCAGTGATCCGTC
AGGAAGAAGAACGACCCGCTGCAACGACGTAGCTGGTGTAGCAATGAGTCGACTCGTGGAACCACCCACGCAGTCGGCGGGATTCATCCTACAGGCGTCG
ACAACACCGCTGGTCAAATGTCTTGGGGATTCTCCTGCCACCCTTGCAAGCAGCGACTACATGTTGGGTGCTTACCCGATGAAGGCGATC