Description :
Non Conding Region
Location :
scaffold_1:127477- 130156
Sequence
2679 bases(100 bases per row)
ACTGCGGGAGGTAGAACACAGGGAAATTTGCACTCTTTGAGTGTAATCGAGTACCTGCAAAGAGCCGCTCGACGTCGATTTCTTCCGCCGAATATGCAAA
TTAAGGTGCTGTATGGTGTGAACTAAATTTTGTGCAACATCAAACCCGGGTCTGGCCTAATTATCAGATAAACTGATGGATTTTTATCGTCTTCGTTTTG
CCTCTAATTTGACCTTCAAGTAAATAAAAGTTGCTCAACGACATCCCTCTTCTTTACGTTGAGCGATTCGAAACTGCGTGCCGCATTGCTAAACTACTCG
AAATGGTTCCATGAGTAAAATCTGCGTAAATTGAGGCTTAGCAAACATGCAGTAAGGAGAGTGCTCTTCTGTAATATTTGATAGAGCTGTCGGTAAGGAG
AGTGCTCTTCTGTAATATTTGATAGAGCTGTCGATAAAATAGGGTCTTGTAATCGTAGATCCATCTTGAGGACTTAATCGCAAAGGAAGTCAAGAAAACG
GTCGAAACTGACAGAGACAATTGTCTAATACTATAATTGATCTGCTGACAATCTTTCCACACGGCAAGCATGGATCCATATAAGACAGCTCGATTTGAAA
CCTCTTGCTGAGGTCtaaagaaaaaaacaaattgCCTAACCGCAACGTTACCAACAGGAAATTTTGCTGAACGTACATTTTTTAAGCAATGCGCCGTTCT
TAACGTGAATTTGAAAAGAATGCTCTTAAAATGTTAATAGAAAAATACTTGAAGTAAATAatgggagaataaaaaaaatgccccaacttttgccatatat
aaaaaaaatatcccaacttttcaaaaaataaaaaataccccagcacgtaaattatcaccggggagccgtaatattacacaacagaatgtattgtattagg
aatgaattagcataatttaacaaaatacccccacaataacaaagtatacattaatatgcaataaccattcagtttactattaaccaagtaaagctaaatt
aaggaatacgtgacttctaaccagtacccacattagctcagatggtagagcgcttgcaaaatacaagcaaaggtCCTTGGATCNNNNNNNNNNCCCGGCC
TGGGAATTGAATTCTGGACCTCCCGGTCCTGAAGTGAGCGGcgtaccactgcaccacaggatcggtaaCAATAGAGATAGCAGAGCGGTTGCATTTAGTA
TATATCAAAATTGCGTAAAATTTTAATATATATTGCAGGGCTTAAGAtttgtgcgtttgttaacgcAGGTTCCTAGCGTCAAAgattcctctgtgcaaag
ctCGCGGTGATCCAGATGCTGAATGCCAATAAAACTTGTTAACACCCAATTCTATGGATTTGAATCGGGACATATTTACGGTCGCATACACCGTCAATGA
TAAATAACTCTTTTTATCGCATTTGTATCTGCCCGTTTTGTGCTTGGAAAGCCACAGATTGATGGCGTATTGCTCATGCGTATAAATATGCTCAACATTG
CTACCATCCTAGCAGAGACGCTGTAATAGCCTAGTGATTATACAACAATCAACGAtctcattggaaagcgtcaCGCACTCATTCATCTGATTCGTGACAC
GATAGCCGATGCTGTAGATCTGCAAAAAAGCGCGAATACTCGGTGAATATTAAAACCAATCAAGTTCAATATGGTTGACCATGTCTTGCTGACCActttg
aatttgccaaagctTTGATTTGTCATTTCGGTTTACATATGTGAAAATTAAGTTTCAACAGCTCACTTAAGTCTTTGAAATGTATCGGTGATGCCTATAC
TATCGTTTCATGTTTCCATGCCGGATTTAACGTTGACAATTGAAGCCTAACGTGTCCTTAAGGATAAACTGTCTTCTGCTTTTCATTCTGGCGTTGATGC
TTCCAATTTGTGTTATTGGCTTCGGTAACACGCTGAGGCCGCTATTCCACAAATCAGCCTTGATGGTATTGTGGTGGTAGTAGTCGTTTTATTCTGAGGC
TTGTGCTGGTGTGTTCATGGTTTGCTGCTTCTGAAGGGGGTGAGAAAATGTTGGGGGATGTGTCATTTATCGCTAAATGCTTTAGTGTCAGTGTCAAAAG
GCTAAGGAAACATTGCCACTATCTGTTCGACTATCGGGTTAAAGTCTAGAAGATATATATGCACTGTGCTTGCTTGGTTCGGCATAATGTCTTTTTAGAC
TCATGTCATTTCTTTATAGGAAGTTAATGCATGCGGGTTGGCTTGCCCAGTACAGGTGGTTTGCCCGTGGGTATGAGAGTCAAAGTCAGTAGTTATCTAT
GCACGCTGGTGCCCTGCGAAAGAAATTTGCTTTTAATTATCTGTTTGCACTGTTATGACTAATTTTTAAGGCTTGCAGATATATAATATCGTTGAAAAAA
ACTGTGTGCTAGTCCGAGCAAAACCATGCACTTCCGTGAACTGTACGGCAGCATGCCCGAATTCGTACGTCACTTTGCCCTCTTCATAATCGGCTGGAGG
TAGACGGTAATCCTCCAGTGATTGTTAAGCAACAGTCATTAATGTGAGCTTGTAATTTTGGAATATGTGCATGTCTTTTGGTAGTCTCACATTTGCTGTA
ATTACAAGTTTTATGCGAGACTAAATTTAAGCTTTTAGTACGGTATACAGTATAGAAACGTATTTAATTAACAGGTTTT