Description :
Non Conding Region
Location :
Scaffold_1:127177- 127518
Sequence
341 bases(100 bases per row)
TCCGTGAATGGCTTTTTATGGAACCAAAAAGATCTTTTTGAATTGCAGGTATCAATTCAAAAAGTCCTCTGTGAATTGTCACGTAATTCAAGGGGTAGGT
GTACCAACGCTGCATTTTTTCCAGACAAGACACTTTCTTCTCGTATATACTGTGAGATCTAATAGCGCAGTCAGGCATTTGCCCACCCTTTCTCATTATT
ACAATAGATAGTCTTCAATCTTCTATATTAATTCTATCCTGCATAGAGATTGACACGCAATCGATCGATGCGCGCTACTTTCTGACTCATTTGCGCTTTA
AGAGAATCCCAATCGATCACGAAAGCACATATTTTGGTACA