Description :
Non Conding Region
Location :
Scaffold_1:126986- 127537
Sequence
551 bases(100 bases per row)
GTGACGGCGTCAGGTCTTTTGAGCCGGCCGCTGGTTCGCTCGCCTGGGGTTTCTGTTGACGCGCCAAGCGACGCCGAGACCTGCCATCGGAAATAGCGAG
GCGGCCGGTTGAAGCATAGAGAGACTCAAGGTGTCATGGAGGTGTCATGGAGGGCGGCGGCGGCGTCACGCGCGAGCTTGCGGACATGGCTTCGCGCGCA
AACCGGACGCGGCGCGCCATTTCTTTGCCGGCCATGACGGCCCATCTTCCCGAGCGGCGTACTGTGCGCTGCATCGAAATGCCTGCGATATCGGATCTCT
CGCTGCAACCCAGTACTATTTGTCTCTGATATATGATGGATAATTGCCCTTAGGAAAGCTGTAAACTGTGAGAACGCATCCGGTTAACTGAGAGAGAAGA
GACTATTGCGTCGCGCACGGTAGTGCTCTCCGCCGCTCGTCGACCGCGCGTCGAGTCCGCAAGTTGCGCGCTAGTGCTCAGTGCTCATCCGTCCGCCCCG
CCCACCGGCCTCCTTCCTCCTTCCTCCCCCCTCTCCGACCCCCGGCGACGA