Description :
Non Conding Region
Location :
Scaffold_1:126842- 127868
Sequence
1026 bases(100 bases per row)
TTGCTTTTTGTTGTAAGTATCTGTCTTGAGCCTTATTCGCCGGTTCATAAGGATGCTTATAGGTTGAGATTCGAGTCGGCATTAAATGCTTTTCGCTATC
GTGCTGTGCTGGCAACACACTGTACCAGCACAGTTTTTTTTCCAGTAATTTGAAATTGTATTGAGTTCCCATTGACAATTCATTGCTAACAAATATTTTA
CGACGTAAAGACAAATATACAAGACGCCGTTGGCTTTAGGCTGGGAGGCAGCAAGTGCAAGTGTCCAGTAGAAAATTGTATTTGTCACAGCAACTTTGGT
ATCTATAAAAAATGCATTGACAGTAGGTTTCTTGCCAAGGTCGTTCCTTGGTGATACCAAATCGTGTGGTGGCTTTGCCAGAATTTTTCAGCGATGTAGA
AGCACAATCAGAGGTTCTCCTCAAGGAGAGCTCCGCTTTCTCTTATTGTAATTTTTCAAAATGAAATTTTCATAGTTCGTGATTTGACCAGTGTGCGTCA
CACAAGATTTGCCCATGACTGGAATTTGCAAATAATAGTGCTATGCCTCCGTTTTCGACAACATTTACACGAAGTTTGCAAAACTTCGTGTAAACAAATT
AATAGGCTTTTGTATGTGAACGCGGAAATGCCCCCGTTCCCTCCCTACCAGACATTCGTCACGCTAGCACACTCACTCCCTCACTTTGCAAAGTATTCGC
GCCGCTCCAGACTCTGTCAGCCTCCCTCGCGTAGCCCCTCCTTTCGAACCATGATTAGCGCAACCAACCACCACTTTGTCCTTCACAACGTAGAGCACTT
CACCTTCACCTCAATCATCGAGGCGAAGAGCGACGAGGTGGGGGCAGTAGTGTTGTAGCAACAAGCAGAGCTTCTCGAGGACTCTACGTATTGCCAGGCT
ACCAGCAGCCCATGCGTTTAAGGGTCCCCGGAAAGGCGATACACTGGCGGTGCTGCCGCAAGAAACGTCATGATGAAGGTAGGAAGGCAAGTCTAAGTAT
TTTAACTAATACCCGGTTTTCTGGGA