Description :
Non Conding Region
Location :
Scaffold_1:126637- 128869
Sequence
2232 bases(100 bases per row)
ttggacggtaggcactcaatgtatccactcgagagagcctcaaaattgcccaccgcacagacgacacgccgtccgtccgcaacgacacggtgtactcctt
cttcaacatcatcctgggctcgaaccccaaagccatccggcaattcaacagtcaccacgtcaactaagcccgtcttcggtatcgcagtgacggaacggtg
ggacggttccacaacgtccacgaactcagccactttctccgcggagcccggagggaactccacatcactcaacacctccgcgtaaggcttgtacgacacc
gaacagtagtagtcaggcgtgttcggctccttcgcatcgcgagtacatgaagcaaccgtcttttccgtcctcttgtcacgctcacagagcgtcgaccata
ctacggccgcgtattcagcgtaatattcctccaccgtcggaactaaccgttcccaatacagaccgtgcaaccccatctccgcaatgatgtcttccgcatg
ttcacacaggcgacgtccgtccaacgcaggcactttgtcacgtaacggaggtatcctcgccgtactggcgccccgggcatcctctctctccaactcagca
tcactccgagcatccttcagaaccgtcctcaagaaccggtacacagcttgacgcgccacggaccgtgaccgcttcatcccggcccttcgtactccacaca
acacgctcacaggaccttcatcttccgttactacatccggctctaatagccctcccagcgagagaagaatgttggagcagaccaggttctcgtcaggctc
cgttccgtccccaatcacggtcgcttcagcgtccgagccggagcaggtcgtcgcagtagttccgtcgggcggtgacatcctcctgtccttcatcaccgtt
ccgtccacgacgttcaccacaggcgtcctaaagtcacggttcgccctcttagcttcttccgacttctgcagcgtgtcactgtaccagtcccgccaacgct
cggggtcgtcagaaccgtccggggacgcatgccgcgtccgttccaagacctccacagggatgcccagatgaagggacagttcttctgttgatggctcctt
ggccgcctcagcgttcgccttcacacggtccatgatttcaccgtccttcagagggtataagcggtcttccaactccttatcgtactcttctggttcagga
cggacgtccgtcccagctagcacggtagcctcctgaccaagctcacctgcctccatagcgtccaactcagcatccgtgaataggcactcgacgtccgtag
ctttggcacggtcgggtatagccctttccggctcgctcgttgtcgtatcaaccgtcccctggtcctcttcagcacaatttaccgtcaacaactcggacga
ggcccgacggcgacccatacgtaatggactaccgtccgccgtcaccaacaggtacccgcgcgcagataccggcaactcagcaacttccggatcctctttc
accgttcctgttgtctccgtaaccgtcccgatagcgcctccagggactaagtccgttccatccgtacactcagtccgtcccggaacaacgtcttcattcc
gcgtgaccgttcctacctctcgcgaggtcaccgcaacatgtttctcgaccttcttcactcgttcggggcgctctgcaccgtcctctgcgaccgtacccga
cgacaccgtctcaccgtcttcctccggcggcttccacatgctcccagcctccgtaccactccgtccaacacgctttacgtgtcgcttccgcatcttcttc
gggatcgggacaggatcaaccgtccctccatcagctctcacctcgtccgcaaaccgcacactccgtcgcacagaccctctcttcttggattgaccgttcc
ggaggcaaccagtcttcacagtcactttcttcaccgacgtcgatcctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctttcttcaattcgccttgcacaaccgcgaccgtaccgtccctctgagcaacc
ttacccacacattctttcgcagtagcgaccgtaccgttactcccacggttctctctgacacggtcaccactcgagccatcccccagactagaggaaggag
tggctctctcctccccttcctcccgcccccgt