Description :
Non Conding Region
Location :
Scaffold_1:126350- 126628
Sequence
278 bases(100 bases per row)
GGGCGGATTGGTTTCGTAAACCAAAGCTGGGTAGGAAAAGTCAACCTGGAGCAAGTACCGTGCGGGACACTAGTGTCGAACCCTGTGTACGAAAAATAGC
AGTGCATTCGTCATTATGGTCATCAAAGCGTCCACCGTCCCGTGTGTTCTGTCTACGTGGAGGCGACACCGCCAGGAGCTGCACACAGCGGCGAAACTAC
TAGCGCGATCGCACTCCGAACGGGTTGGCAGCCCCTCTGATTCTCGTGCACGCTGAACGCACGTCGGCCTGTTGCATC