Description :
Non Conding Region
Location :
scaffold_1:126161- 126637
Sequence
476 bases(100 bases per row)
ATGTCATGCAGTCCTCCTGGGGTGTTTATAAAATCTAATTCAACAAGGATCTCCAGCATGATTATAAGCTGAATATGGGAGGAGTAAGTTGACGCCCACT
GTCTTAAAAAGCTCGACAAATGATCTCAACATTAGAACGTTTAGTAATGCCCCGTGCAATATATTGGTACGGCCAAGATATTCTATTTTCTGAAACGGTA
ATTGATTTAAAGCATTATCCTTAGTGTCGaatctcaattttttcgaAAACTACGGTGAAAATAACTGAGAAAACATGAACGCATTGGTCACTTTATACTT
TACTCACACTACGAAGCCTTCTTCTCATAACACTACGACCTTGTTCTTCATTAGCCGCGCTACACATTATACAGTCTGGGGAAATCTTTGTTGTGCAAGG
AAGCCTACACCATCTTCACAATTACCGTAGCCCGTTAAAAATGTAATCCATCGTATTAAGAAATCACTTAGATCCT