Description :
Non Conding Region
Location :
Scaffold_1:126063- 130271
Sequence
4208 bases(100 bases per row)
GGAAGTGCAAACACGAGCCACCGGTATGTGAGTTATCTGGCAAAGCCCGGCGGATAGATGTACGAGCCCGTCAAGTATACGCTGTACATCCACAACCAAA
TACCAACGGTTGTCAATGGCCATCGATAGGTACCTCCAAGGTCTGAAAATACACAGAAACTTTCTGTTGCTGCCGGACGATGATAACTCCAGCAGGAAGA
TATGCTAAGCAAATCAAACAATAAAAGCAGTGCAGCAAGCAAAAAGTGATTAAGCTTACCAGTAGAACGTGACTGCTATGCGTATCTAGCCATAACTGCA
GTAGACTGCAGCTGTCATGTCGTGTCTCGTTCGGGCAGGTATTCACGCGAATAGGAGGTGAATGTCGTTGCCGAGAGGATCTCGATTCATGAAGTTCGCC
TCCAGTCTGTGCGGGCAGTCGGCGATCCCCACGAGGAATGTCGTGGCGAGGTGGGCTGTTGGGTGTGCCGTCTCCATGCCTCTCTGCATGAACGGGTGGG
CCTCCACTGCGCTCAGCCGCTCCCGCATGGCCACCATCCGCCTCATGTCGGCGGCGATGGCCATCACGCCACCGAAACTGGAGCCATGCGAGTGAGCGAT
GTGATCGACAATGTCGACCGTGAGCGACTCGCAAGTCATGCCAGGGGGGCGGACGCGCAGCCAACCTGGCGTTCGAGGCGCTCCGGGCGCTCCGGCGACG
AGCGCGTTCGCCGTTGTGACGAACTGCGCGAGATCCTCGTAGTGCCATTTAAAGACGACCGCGGGGTCAGCCTTCACAATGTGAAGTTCACATGCCACCA
CAGTACACATGTGAGGTGCGTCGGGATTAGTCATAAGGGAAGTAAGCAACTGCAACGGTGTACCACGTCGACTGTGGCAGCTCGAGTCGCGCTTCTGCTG
GAGCGCCGGGGTCTTTTCGGCGGCGCAGGTGGCGGGTCGGCGCTTACTCGTATCCAGTAGGCTCTGGGAACGACGAGGCCCCATCGTCGCCAGCCTCTTC
TCCTGTAGGCGCTGGGAGCGCCGCATCGTCCAAGCCTGGAAGCTTCCGGCTGACGTGCTCTGGAGAAAAATGTCAAATGGCGATAGCGATGACTTTTCTC
AATCGACTCGAGATGATACAAATTTTCAAACTGTAACAACACAAGCTTTGTCAGGAGGAAACAGAATCGACACAACGCAGCAAGTTAGCGCTTGGAGGAC
CAACGTGGTCCCCCAGCAAGGAGTTCCGCCGCACATCTCCCATCATCATTTTACAGCTCACACACACTGTCAACCCGCCGGCACACGCCTAAAACGAGCA
AGGCTATAGCAAGTTTGGAGAAGTGGCAAACAAGAGAAACTCAAATCAAATGAACGCTTGAGAAATATTTGCAGCTTGACATACCCATGTGTATAGTTAC
CATAAGCTTAGGTAATTTTTGGAGGGTCTGTGTCGATGATAGCTATACTATAAGTATTCATGGCCATGCCAGTGCATAAAGCAGAAGTCGAAAGTGTGAT
CCACAGGAGACACTTACGGATCGTAGTTACGGGAAGCTATGTAGTAGTTCTCACGCCAACTTTTACAGAGACATTGAGCAGACTATTTTTTATGAGCCCT
TTAATTCCAAAGCTGCTTTGCCACGACTACCGGGGAGTCTAACGCTTTGGTCGCCACGACCGCTACGCACGACAAAATTGCCTTGGGGGGGATACGGCGC
GATCTTGACTAGAGGTCGTGGACTACAGATAACTTCAGGGATAATAAATGGCGAAAAAAAAAAACGGAGCGCAGGGACGCTGCAGTACACGAATTGAAAG
ATGTTTTTTGCGGGTGCTTACAGTTGGCATACCTGTCGTATTTGTGATTGATTGAAACAGACAGACTGTCCCGAGCGTTCGCAGCTGCACAACTTATTTT
CCGAGCAGGAGAAACGAAGACCTCCAGCAGCCACCATGGAAGGCATACATCTTTGAGTACTCTTGATTTGGTGCAGAATATTTACCCCTCGACTGTGTGT
CGTTCGTTCATGACGAAGGTATCCAACTATGCGGCCGAGGGCTTCGCTCTGCTTTTTAAGTGGAACTTCAACGCTTTGAACGCGTTTATCTTACGCATAA
ACGCCGTTGAGGCTGGAGCTCCGAGCTCGCCTCCGTTGCCAAGCTGGCTATGCGAGCGTCCCCCCACCATAACTTGTGAGTCGCTCACCGCCGACATCGT
CCGTCGAGTCGCCGACACCCAAGGACCGAGCTTCGACGGAGTCGTGGCGGTCGCAGACGACCAGAGGCGGCTGTCGGGCATGCGTGAGCGGCTGAGCGCA
GTGGAGGTCCACCCGTTCATGCAGTGGGAAATGGAGACGGCGGGTCCAAATGACAGGCTGGCCAGCACGATGGTGTTGGAGATCGCCCACCGCCCGCGCA
GACTGGTGCCTCGCTATCTACACCGCAAAGCCCTCGGCGAACGAAATTCGTATCCTATTTGCGTGATCGTACGCCGTCCTCGGCTGTTGCAGGAGTACTA
AGTATTGAGCAAGAGTTATTCTGCTCTCAGTGAAAGCAGAACCCAATTCCAAGAAGCGGTTTCTCATCCAAAGTTGCGGCAGATGTGTTTGTTTTCTCTT
TCTTTCTCTTCTAAACCTTTCGTAGCAAGCCTACTACTGCAGAAGCGGCCAACTCGTGGTGAGTTAATAAGGAGTTTCAACGGGCAATTATCGAGATACT
ACATGTGCATGTATGCAGGAGAAGGCGAAATGCGCTGGAGAAGTGCGAAAAATGATCCGAAAAATGATCCGAGAATAAAACACACAAAGTCGTGCTGTGC
ACGAAGAAGCTCTGAAATTTCGGCTGTGAAGTCCAAACTTTTAGCTTCAAGTGTCTGCTACTTTGTTTGGTGCATGTTGCTCTAGGCTACTTGCACGTTA
GGTGCTCGCCATCTTCTGACAAACCTCTTGGTGCTCGTCACTTCATTGACAGTTAAAGTTTTGTTGACATGTGGATGGTAACTTGCGCAACCTAATATGA
CGAGAGCGCAAGTGCTTTCGGCACTGAGTCGAAACACGCTGGTTCAGTTGCTCCAAATCTCTGGACAACCTTTTCTTAAATTTTAACTGTACACACATAA
CACATATCGTCCGTACTTCTCAAACATTCTCCTGAGCGGCGCCCCTGCCGCGCAGCGTGCACCTGATCCATTTTGAACAGGTCTTCGTTCACTATCTTGT
CAAGCCTCAGACGGCGGAATGAAGTCGTTGGGGCACATCTTGACACAAGTGCGGAGGCCGTAAGCCCCCATCGAGTCGCGACTCGGATTGGCCAGCATCC
AGACGGGAGTGGAGATGCCAGCAGACACGAATGGCACGTGAACGTGTAGTTCGGGATCAGGTCTTTGTAGAACATCCACTTGAGTCGGAGTGGCAGCCGT
GCAGTAGCAACGCTAAAGCAATTTCATGTGCTGTCGAGTATTATAGGCGCACTTATGCTCAACTTGAAGCCGATCAACTTTAGGAAGTAGGATCGCTTCG
AGCATTTCAGTCTGAAGTCCATTGCGTTCAAGAGTGGGTGAGATACACTAGCAACAACGACGCTATGCTAGCAGATGCATGCAACAATGATTGAGTAAGC
GCTCCGCCCTTCCATCAATATTTTTACTTCGGGCAGTACCACGACGCGCCCTGTCCGTGGATGCGGGGGTCGATCACATCGATTGCTTCGGCCATGATGT
TCCACATGTCCAGATTCTTGGCGAAGATGACGTCGCTGTCCACGACCATGAAAAAGTCGCCCGCTGTCGGTGCGTAGCGCTTCTTAAATGGCAGCGACGC
GGATGTCGCCACCCCCAGCAAGCCAGCACCACCGTACTCGGCCGCAGGTAGAGACCGAAAATTCGGCTTGTGTCGATTATCCATGGGTTAAATGAAAATT
TGCATTTATCCCAAGAAAACACCCACCTAATAAATTACCGTTTAAATTACTTGCAGTCGCAGGTTGCACGAAGATGGACGCGTCGCCGACAGGGTCAACA
TTCACGTGGGTGATTCATAAAGACCAGAGGTATAAAGTACTAGAGGTTTTTTTCATATTGCATTCTATCATCCACTGTTTACTTTGTATACTTATCGATA
AGATCTTCGGACAATCAGACCCTTTAAATTACGAAGGCTGTGTTTTTTAACAAAAAACATTATTTATGAAGTTTAAGAAATGGGTGACCCGTACAGCAGA
TATGCAAT