Description :
Non Conding Region
Location :
Scaffold_1:125753- 125957
Sequence
204 bases(100 bases per row)
CGGCGCTCGCTGCTACTTAGCTCCGTCATCCGCCAGCAGAGATTCGATTTGAACACGATTTCAAAAAATGCGCGCGCAGGAGTGATGGTCTGCCCGATGT
CCGGTGAATTGACCGTATTGGTGTATTGACACACCATTGAAGCTGCCGACCAACCAAAGCGAAGCGGCATGCGCTTCACTCCATCAATTGAGCACTTGAC
AAGA