Description :
Non Conding Region
Location :
Scaffold_1:125603- 126030
Sequence
427 bases(100 bases per row)
CGTGGTGTTTTACAAGGCTTGGCGAACAGAAGAGGATTGATCTCACAGCAACGAAAGCGACGTGGACAATTGGTGGAGGGCCGTGATTCAGACGTAACCA
GATCCCACATTGACCAGATCTCGTCGTGACCAGATCTCGTCGTGACCAGATCCAGTTGTTGCTGGAAACTCGCACAGAATGTGTGCGAGCTCGTTGAGCC
GACTTGATAAAATCAAGTCGGCAAAGCTTCGACGCTGGATCGGCGACTGGATTTGACGCCCCTGTCGCAACGCATTCGCCAATCAAAACGCGCCATTTCA
AATCCCCTTAATTCCGACCAATCACAGACGTCCTTTTCATCGAAAAACGATCCAGTCGGAATGATGGTCACCAGCATCCTTGGCCCATCGATCGAGCATT
TCCCAATTTGCCAGCAACCAACGAGCA