Description :
Non Conding Region
Location :
Scaffold_1:125599- 125772
Sequence
173 bases(100 bases per row)
CAAGACACGCACCAAGAGAGCAAGCAGACGTACTAAATCATAGCAAAAGGGAACATCATATTCTGTCTCAAAAGCTCAGAAAACGAGAAAAGGACAACTT
CTGATATCAAGGCTTCCAAGTTCACGAGTGAACCCACTGACGACTGGAAGCCGCGTCAGATCCTGGCGGCTTT