Description :
Non Conding Region
Location :
Scaffold_1:125494- 126124
Sequence
630 bases(100 bases per row)
agtagctccatcttcttcacgtccatcactcgatctccatctgctccgttcagctccccgactgaagacggaagtccgtcgtctccaacaggctcatcca
taccgtcccaacagcaccgtccccagcaatcgttccgtactgctccccgactgaagacggattctcgcccccctttcagcaggtcacgtatcgttagcgc
agccacagtgtcagtgaacaaccgggataggctatccacatggcccatcaacgttccaggcttgtggtgaaccttgaattcctggttagacaactccata
gcccaccgtgccagcatagcgttcgtggtacggttaccaggactgaagacccacgtcagtgcctggtgatccgagaacagatcgaactcacgcttgtctg
gtggcacgtccggcctcgacttccgctctttctcaccagtcgtctcttcacgctcctcggcaacagacgacgaccgtcctagaccgttcttctcaaccgt
tccaagcccaccagtcgcagtattcgtcgctggtagctcgaacgccgactcgaggatcacggagacacacgctataggtgttccccgacgcacccagcac
tcatcggtagacgcattacagatctccaca