Description :
Non Conding Region
Location :
Scaffold_1:125197- 125738
Sequence
541 bases(100 bases per row)
AAGCCGCGACAAGGGATCCAAAACCGCAGCCTGTCTATTTTGGTGATCAATGACCGAGCTGGCGACGCCCGACACGAGCGCGATCGTCGTGTTCAACGAG
CTGAGCGCCAGCTGCCTCCCCAAGAAGGACCCACCCCCGCGCAAGCACCGGCGCCTTCTATTTATGGTTGCCGGTATGGCGTTTGTCCTTGTCTGCGTTG
TCGTTGCAGCAGTGCTGACGCAACAAGCGTCGGCGGCTGCGTCCAACCCAGGAAATCTACCGTCGACGACGAGCAATGTACCGAGCTGCGCAATACGTGG
GTGGACTACTGAAGCTTCTATAGAGCGAGGCGACGCCAGACGTCACCAGGACAGCACTGACGTCACCACCTGCCACCTCCGTTTCGGCGACAACGCCACC
CGCGTTGACAGAGACCAATGGTACACCTCCCAATGCTTCTCAAGCGCCAGATCTGACGCCGCCCCCGCCAGCGTCGACCATGTCCCCCTCAAGCAGTACA
GTAAATGTCATTATGCCTCGTGACGTGAAGATGCGTAGTCA