Description :
Non Conding Region
Location :
Scaffold_1:125184- 125344
Sequence
160 bases(100 bases per row)
TTGCGATTTGGATCGGCGCGAAAAGCAAACACACACAAAAATGAGCGCGAGAGTTATAAGGCCGCTCTATGTGATGTATCCTACAGGGTGATGACATCGA
TAACCTGGACTCGACCGTTTAGTAAACCGGATATTCCAGATTAAATGCTGCCTCACACCT