Description :
Non Conding Region
Location :
Scaffold_1:125127- 128231
Sequence
3104 bases(100 bases per row)
CTGCTCGTTCACTGCGAATTCCACGGCGTTAGCGTCGTGTGGCCAGTCGCAACGAGCCCGTCGATAGCGCGACGTACCTGGCACCTCACGGATGGGTCGA
GAGgAAACGGGGCGTACAGAGGAGGAGGAGAAAGAAGAAGAGGAGCGGATCGGCGGACTTGGCGTGGCGGTTCcGCGGTCGTTGGTCTCACACCTCAATA
TAGCCAGGCGGCAGACGCAAGGCAGGCAGGAAGATGCAGAGATAGCGAGCGGAGGCCAGAAGAGACGCAGGCCGTCGAGACGCTTTCGATCGATCGCACT
GCCGGCGCGTGAGAACCACTGCGCTTACTCGTCCGTCCACGCGGTGGAGGGCTTTCAGGTGCAGGTTGGTTTGGTTGATAGTATTGGGGGGCAAGAGATG
TCGACGCACGAAGGCACACCAAGTCGCGGGCGACCTCAGTGTGGGTGAGTGCGTGAGTTCAAAAAATCGCTGAGGTTTtGAAGAAAAAGCGAAAATAACC
CACGCCCGACCGaCAAAAAAAaCAACCGCCTGCCGCCGGCCCTCCCCCCcTCCCCTCCTCCGTTCCCTCCGCTCCCCTCGGCTAAGGTTTtGCAAGGGgA
GTCCCCCCTCCCCGTTCTCACACCTAAAAAaCCTCGATATCTGAACACACTTTTTTGTTTTCAAACACAAAACATCGAGGTGTTTCCTTTCGCGCTGTTG
CAACCCAGCGTTGCGACTTGAGGGGAGGCCCTtGCAGTTTGTAACAAAATGTTACAATCAGCGTTTCAAAGGCCCGAAGCAGACCGATCCGTCAATCTAC
CTTGTTTCGGCATAAGACTGGCTTTTTTTGCGCCTGTGACgCCGAGAAaGGTTTCTGCGAGTGCCGAGTGCAGCCATGTCATGTCATCCGACGACCCTTC
ATCCTGTTGAGTCGGATCTGCGGGCAATCCAAGTCGAAGAAGACGGAAGGAAACGCCACGGTATGACCAAGCAGATCAACACGACGgAAAGGGGCACGTT
ACcACCCTGATGTCCTGGTCTCAGTAGTGTCAAGCAGACTGGTTGCTGCATGACGCTTTCGGTGCCAGTGCATGCGGTATTACAATTGCTGCCACGTGTC
CAGGGGTCTCGCCCGTCGCATGTTGCCAGACATTTCTGTCATGGTAGTGTGTGTGTGTGTGCCTGACGAGTCCTCACTCCTCCTGATAACGCGGCAATGG
CTGCACTTGCGGCTGCAGTACGGAGAGCAAAGCATCTGACTGTACGGCTGGCTTTACTGGTCGCGATCTGGTTGAGCCATTTCGCGACTCGTCGAGCCGT
CCGCGAGGCATCGACGCTGgCGACTTTCCATGCGCGTTAACAGCCCCGCGACACCTTCCGCTGCGCGCCGGCGCTGCTCACATGAGGCCTCGCCAGCCAT
GCGCAGCGGGCGCCATCCGCTCGGGTGACTCGTGCGACACTCTTGACGAGGATGCTCTTCAAGACGAAGGCGTGGCGTGTCGCCTCCTCGCATGAAGGTA
GTGAGTTCGGCTGTCGCTAACGAGTGCATGTTGGTGAGCGCAACAGTATTGCACGAGTGCCGATACCTACAGATTTATTACGTGCACTCGATTCTCCTCT
TTCtAGTTTTTTTGtGCCTCTTGTTCTCGTGGATGGCTGGACACGGCAGTCCTGGGACAAaGGGGCAAGAACAGCACGGAAAGGGATGTAGCCACTGCCG
TGACCACGACAGGTCTAAACTGCAATGAGTAAACAGGCGACTTGGTGTGGAGCCCAACCGCATGGAGGCAGATGGTCCCGGTGGAATGACCTCAGCGCGA
CCGGCACGCCGACATtGCACCAAtCTTTTCGCGcTCCCTGGATCTGGTGAGTCAATCAGTCTGTGACTGGAACACGCTCCAAGACTCAGAACTTGTTCTG
GAACGATCAGATCACGAGGCAAAGCAGCCACAACAACAGGGACGAGGGCTTGGGGTTGCTGCTTGATCAATCGTCACGAGTACCGTAGGAGACACAGGCT
GTCACCTTGCCCATCTAGCAAGTAATCACGTCCACAGGAACGCACCGGGAGAGATGACCTCTCCCGACTTCGATAGTCTATAGACCTAACCCCGAAATGG
GTTTTCACGGGGTTGCCAAAAGAGCCTGCCCCAAAGACCTGGATTTTGGCGTGGCGACTCTCGTAGCAGCTTCACCCGTCTTATCGACAGTCCCAAGCTC
AAGAATCTGCGGTGAAAAGCAACCGTGACGATTGGTGTGCGTTGCGAATAACACTCcGAACCCCTGCGTTCACGTGTTCTGGCGATACCTCCGGTATGTA
TTCGGAAAGCTAGTCCTACGTGCGTTTGTGTGCTCGTTCGCGCGGCTCAAGGAGGCAAGGGCGGATCTGGCTCTTCTCTCCCACCTTCGATCCTGCAACA
CACTGGGACGACGAGACGACGCGCCGCAAAACGGCTGTTTTTCCTAGCTCTCCGCCCCTCTCTGTTGCCTCTCGCTCTCCCCGCCTCTCTCTAATTTGAT
GTGAAAAGCGTTCCTACACTCTGGGAACAACAGCAGGTCCGAGTTTCAGCGCGTTCAGTCGTCGTCGCTCCGTCGTCGGGCGCTCCTCCTCTCCTCCAGT
CTCTCCCAGAGGCACTCAGCATTTtGGACGGCGGACGTGCTGTAGGGCGGAACCCCCCCTGCACCAGCGAGCCAGAGGTGAGAACGCCGTCGGCGCCCCc
TTCCCTCCTCTCTCTCCCTCCCCTTCCACAGTGTCTGTATTTGACTGACGCCCACTCGCGCCTTCAGACCCGCATCTGGATTTCAGATACGAGACCGCCC
ACCCACCGGACACAACCCGAGAGACTCGCTTCCTCCCTCCGTTACAATCGTAAGTGGCGCATACGCTCTCTCCCGTTCTACTGCTCGTGCTCGGCGTTGG
CGACGGCGACGGAAAGAAAACTCCGGTGGAGAACACCAGATCCGCTCCCCTCTCCTCCCCTCCGCTCCCCCTCCTCCCCCGCGTTCTGAGTGTGGATCCG
TCGACGTCGACGGCGCTGAGAAACGAGCTTCCGAACGCCCACCCGTGTGTGTGTTTGTCGGTATTAATTGCGTCTCGTTATGTTGGGTCAAGCCACTCGA
AGCA