Description :
Non Conding Region
Location :
Scaffold_1:12476- 13588
Sequence
1112 bases(100 bases per row)
TTTTGCGCGGGGGGAGAATTTGCGAATGGGTGGATCAAATTTTTGCGGAGCGGAGTGCTATCATTCAGAGACGTTGGACTAGAGTAACGTATGCCAGGAC
CAATATACAAAGTCCAAAACGATTTTGGGCGCGAAACACAGATTTGAAATTTcggacgttgaagtggcggTGGCGCCAACGGCGCTGAAGGCGTCCGCGC
TTGCGGATCGGAGCGTGGCGCAAACGTTTTAGGCCGTGTGGCGTGTATTACATGCAGCAACAGCCCTTcgagtcgagcagcaggGCATTGAGAGTGAGGG
CAGGCAAGAAGCACACCAAGCGTGGCACAGACCAAAAACAATATGTTTGCCAGCTCGGACTAATCTTTCGGCTGCAAATTGCTCTGAAGCACGAAACTCA
CTTTTTAGATGCTCACCTGGCACAAACAGAGTTCCGTCGTGGGTCAGCACGAAATCCGCGCACTCCGCTATAATGCTTTCCAGAGCGCGATCGCAACTTT
CAAGACGAAGCCCAGGGTGGTTCGGACGGCAAGTGTTTCAAGACGGTAAATGCCGGATACCTATGTTGGAATCGCTATCTCGGGTTTTGCAAGTTACGTG
TGGGTGTATGACCCCGTTTGGCACAGATCCTCAAGCCTTGAGGCTCAAAGTGATTCTGCTCTCTAAACGCGCTAAATCCAGAACCGTATACATTCGGTCC
AGCAGGACTCTTGCTGGACTGGTCACCAGAACGTGAGTGCTGGCTCCGTGCGGCGCTCCTGCAAACTCGTTACTCTCCTATATTTCAGCTTTGTCTCTCG
TTAACCGCAAAACATCTCAGTGGTCTCTCCTCTTCGAAGTGCGAGTGTATGAAGGTCTCGGGTCATCAGGCCCGTTTCCAGTGCCTTCACTTCCGTTGAC
TTGAGCGAATGGAAAATGCCGTTGACATTATTCGCAGTGAGTAGCACCACGGCTCCGGCGTCCTTCAGCCGGCTGGGTAGCAAACGTCTTGAAGGGACCT
TGGCACTGGTTAAACTGGTAAGTGATACGATAGAGAAGACAAAGTTCCGCTTTAGAGGAAGGGTACCAACAAGAATTGCAGAACGTCAAATGCGAGAACG
TATACGTTGCAT