Description :
Non Conding Region
Location :
scaffold_1:124456- 126723
Sequence
2267 bases(100 bases per row)
GCAGCTATGGCCTAGATGCTGCATGATTTAGAAGAACATGAAGGGGTCATTTCTTTACAAAACAACAAGAGAAATGCTCTATCTCAAGCCACTGCAGTCC
TTCTGACGACTAAGAGCAGCATTAGCAGCTTTAAAAGCACGAGTCTTCTTTCGCTACGTGAAAGATACGACGCGTGAGATATCAGTTCGCTCGAGCTTCC
AAGCACAACATGAAGCCTTACTTCTTCTTCTAACAGTATCATCAGACGCCGACACTCCGCTGTGTTTTCAGCCCCGTCAGTGGTCTGTAGCTCCTGCGTC
GCTGATTAAGATCGAAGTCCATCGTTTTTGTTGTCAGAGCGTTCATCGTGCTCTTTGTCGAAAGTGAATTGGTTAACGAGTGGCCGGTTCACTCGATCAC
GTAGAGCTGTTGCATATGTGGATTTCGTTCTCCGCACTGGCGCTGATAGTGGTCGTGATACCTTGGTTCGGTTTATTGCTGATGGCAATGGTGCAGCAGA
GCGTGGATGCTGCAAATGTAGTCGTGCTGCGACCGTTGTCATCTAACACACCACAATTAATTAAAAAGAAATCCCTAGGTATAACCAGTGAGAACAAGTA
CGTACAATGGCTTTAACGTGCCGCAACTTTGTTGTGTCTGCCAGAATATTCTTCGGCAATGAAAATGTTCTAGTGGAAAAGAATAACAAGTTTAAATACA
AGTACACAGTATACTCCGCGGTCAAGTTTCCTCATCGTACCGCTGGCTGGTATCCACAGCGCTTACTACCCGTCCGACGTATGTATACAGCTCTAGGCAG
TCCTCACGGATATTCTACGATAGCCCGAAGTTAGTATCGGCACAATCCCCACCACAGTACTCAACGTACATCCATAGTCGCTGTCGTAGTCTCCTCAAGT
CGTTGCAGCTTGCTATTGGCAATATTCAGCTCTTCCGTTTTGTTTTTCAGAGATTGATCATACTACAGTAGCGTCGTCATTAGAATCCAATCAACGTTAG
ACTGGTAGCTTCTGCTCCATTTACCTGCTGTCGGATGAGAGCGATCTCGGTCTCTTTCGCTTTCTGCAAGGCTGCTACACGCTGACGCAATCTCTGATGA
ACAAGAAGCAGATAAAGAAGAACTCCCATCAGGATAACGATCAAACAGATATCGAAGCAAATGACCTACCTGGTCAAACTGCTTTTCACGATCTTCACTG
GCATCTACGTGAGGGTTGATACCCGAAGTAGAGATTTGTTGGTACGGCATCTGACTCTCCATGTTTGTCTGGTTGTTTCGGCTCAGAAGCACCAGCATTT
CGGCTCTATGCCGAGCCGCTTCCGACGTCAAAGCGCGCTCATATTCGTTTGATTTTTGTTGTAAACAGCCTTCCAGCGTCGCAACTCTGCGCTTTAGGTC
CTTTATTGCAGAGCGTGCGTTCTCCTTTTCCTTCTTTGCTTCCGTCTGAAGACGACAACATCATAAGTGTTGAACAGTCAAAACAACGACGCTAGTGGCC
TAAATACATGTACGCACCACAACTACTGTAAAATTGCTTTTTGCGTTGGCATATTTCTGCCGCAAGCGGTCTCGGTCATTCCGAGTCTCCTCCACTGTTT
TTGGGAAAACAAGACAGGGATTTTTAGCATTCAAGCAGCTAGAATTCTGATTAACTGCTGTGGTAACGCACCGTTTGCTCTGAGCAAGCTTTGCACATGC
CCTGTAGATCCCAGATGCTTGTTCTTCAAGAGTGCGCTGGAGGCTGTGATACTGTTCCCTGGTTCTTCATCTGAGAACACTGATTTCAGCACCAGACCAT
CCTACGGACAGAAATATTCCATCAACAACTTGAAACTCAGTTTAAGATTGTTGACTACCGTACAGCGAACTTAATTTCGCCATTTTCCGATATCTCTTCG
GCCTGAAAGCCGAGCTCGTTCAGCGTAGTGACAAATCGGTTGTTGTATTCAGCGCGTAACCCCTCGAGCTGCCGGCGCAAGACGCTCAGCTCTTCTTGAA
GTTTACGGATGCGTCGATCTTTGTCTGCAATAGTCCCATTGATATGGTTTACACGGGGCTAGACACACGAAATTACTGGGTTAGCTTTTATTCAACTATA
ATTTCCAATAGCTTACCTGGTTCTGCACCGATCGACACCGATTAGCAAATTGCAAAGTTCCCAAGCATTCTTCATAGTGTTCTTTCATCGGGTGAATCGT
TGCAATGAGGGTGGTGAAGCAATTGCCACCTACAAGGATAAATAGGTGAGACAGTGGCGCGCCATCC