Description :
Non Conding Region
Location :
Scaffold_1:124218- 124614
Sequence
396 bases(100 bases per row)
TTCGAAATCTTACAGTTTGGGTGTTTCGCCCGTTGCATCTCGGTCCGTCCCCATCATTTTATTTGCGTGGCACCTTGAGAAGCTCGCTCGGGCGATCTTA
TGTCTCGTCCTTCATGTAGTGTTTTGTGAATGAAAAAAAGTGGTAGGAGGAGGGTTTTTGATGTGATAAAAGGAGGGAGAATTTGAATGAGAAGAATGTG
TTTGAAAATGAAGTTTGTGATTTGAAAAAGTAGTTGGCTTGCGAGAAGGCGACGTTGGATTTCAGTCGTGTTTAATTATGGCTGATTGCGGCATTTACGA
TTTAAATATGGTATATATGGCATCAACCACCTGTCAAAATATGGTTGCAAGCGGCATATGCCATTTTGAATCGCGTCAGCCAATCACATTCGAGAA