Description :
Non Conding Region
Location :
Scaffold_1:124044- 124344
Sequence
300 bases(100 bases per row)
GGGTCTGATATTACAGTTACGCTATAAATAGCGGCCAAGGAGATATTGACACTCATCCAAGTCTCATCCCTGGAACGATGCATGCATGATGTCGTCTACC
TGTACTAGCAGGCGGAACGATTGCCGCCGCCATCGTCATGTCCTGTCGCCTTCATCTGTCCACGACCTGCATATATACATGCCGCAGCCGAAAGCGCGGG
GAAGTTACGCACTTTAGAGGACGTTAGCTTGTTTTTTGTATGTCTTGTTTAAGTACGACACCAGAGAGCGTTTTGGTTGGCCCATCCATTCGATGTTCAT