Description :
Non Conding Region
Location :
Scaffold_1:12381- 12570
Sequence
189 bases(100 bases per row)
CTAGAGTTGGTGGCGGGGGGTACGTGTACCGGACAACTTCAACAAGCTTCAACAAATTAAATTCAAATCTGTGTTTGGGGGTACAAATGCACCCTTCGAG
TACCCTCAAAAGTGTAACCACGTACCCTAATGGTAGGCCAGCCATTCCTCCAATTAAGCCCGTCACTAAGCAGTAGGAAGGAGCCAGGA