Description :
Non Conding Region
Location :
Scaffold_1:123790- 128351
Sequence
4561 bases(100 bases per row)
GTCATGGCTGTCGTCGCTATTATTACTTTCGGCGGTTGTCGCGGACGTCTGCAGACTCGCGAGCTCACGCGTCGCCGCGTTGCTGCGGCGCTGGCGCAGT
TGGTACCGGTGCGTGGCGCTGGAGGAGGAGGAGGAGGAGGGCGCGACCGCCTTCGTATCGCTCGCAGCCATGGCGAACGGAGACAGCGGCGCTTGTAGAG
AGCGCAATGGTGGCGGAGCTCCTGCTTAAACTGTTGGAGGGCCGCGTGGCTTTTTGGCAGCATCCATCATATCTAGAGAGAGCGCACACAATTTTTTGGC
CTCGGATAATACGTAGATGCTAAATATCCTGTTATATAAAGGCATTTTATGGATTGTTTGTCTAGACTGGAAACAGCTGGATAGAGAGTATGTGATACGA
AGAGGGTGAAGGAAAGCATTTGTTGGCCAGATTAATTTGCGCCGGATCAGATTCCTCAGCCATACAAAGCGAATCTGAGTCGGATGCATCGACTCAGCTC
TACATTACGAGGCGTCCGCCGAAATGACACGCTACATGTAGCGCGAATGCGTACATTGCACCTGTGCTCCATAGCTACCGAATCGGTAGCTACTCATGCG
ACACGAGCGTGTCGCTCTCCTTCTCTCTCTCCATGACGCGGTTGGCGTCAGTCATCCGTTGCCAGTTGCCTTTCCGGCGAGAGAGCAGCGCACACCCTTT
GACTATCGAAATGACGCACGTGGCAATCAGTCGTTCTTGGTACCGGGTCGCTGCTGGCAATCACGACACCTCGCAGCACAATGGAACGCATTGCCGCTCA
TGCGCGAGATTACAGAGAGCCCAATCGCTCGCTTGTCACCAGTCATCCTCTGTCGGTTGCCTTTTCAGGGTGATGCTGACGCACACACTTTGATGACAGG
CCGCTCTCGGGGGGGGAGAGAGATCAGCGCAGCGCTGGCTGGCTGTCTCTACGGCGGGGACATATCGAAGAAGGACAGCCGGATCGTATCATTGCTCCAT
GAAGCGTAACGTAGTGCACCCATGAAACTACTGTAGCTCTCTCTCTCGTCACGAAAGAAAAAGAGATCGTCGATCGTGTGCTGCGTGGCACGACGCGCGC
GTTCCTCACTTTTACATGCTATCCAGTGCAATGCCGCAGCGCGAACAACCAGAGGGGAACCCATGGGTGTCTATGTTTGCAAGCGCTTGATTGCACCACG
CGCTCTCTTCCGGTCGTCCTGCGTGTGCGCCACCCACCACAACCAGACGTCCAGGATGGGGAGGAACAAATTATTAAAACTTTCGCCATCCGGACATCTC
AATGGACACAAATCGCGTGGTGGCGCACCTTCGGATGCGCGATCAACACAGACAAGTGTTCATTTGTTGCAGCACCGAAGGATACTTTTCGTTGAGTACA
ACGCGCGACGCGAATGGATTGGCCGACCACCTCCCAATCTGAAATGCTCGGGAACAGCGCTGAATACCTACTGCACTGAAGCTCTTGCCAAAGCGAGCGT
GTGCAACGCGACTGGCGTGTTCAACGTTCAATGAGCAGCGAGTGGATGATCCCGACAAGTGAGACCGTCATCGTCGGTCTCACGTAGTGATTGTGTTGCC
GAGAAGCACAGCGCAAGTGGGGACGTCAATAATAATGCAAGCAGCGCAATGGAAAGTGCATGCAACCGGTCTGCTGCCTGAGCTGACAGTGCGAGAATAC
GCGAGCTAAAGAGGATTTTATGAGGCGAGTGATGAGACGGCGAGTCTCTGGGGTATAAACGCGAGGCAGACGTCGCGAGGAGACATGGACGAGCCCTATT
CTGCACTCTCTTTCCGACGATGAGTGCGCACGCGGGCGATTGCTTGAGCTTGCACGCCATTTGTGCCTGTGGCGTCAGGCGGAATACTTACGCAGTGATG
ATGGATGGATTCTCGGTGAACACTCAGTCGCGAGCCCCGGTTCACTTCGTTTTCTTTCCAATTGCCCACATGTCTCTTCTACATAGTGCTGTACAAGCAG
CGCAATGCCCGCATCAAAGAACAGCGGCGCATGCCACAGTATGCGATACTGGCAGTCACGACTTACCTTATCAATAGAAGATGGCACAGCGCCACAACCT
AAAGGCTGCGCTGAACCTGTGAGTTAAGAAGCGGCCAGCAACTGTCAAAGCGAACAATCAAGATCGATTGATCGACTGTCTGTACCGTGAAGATGAGGCG
CGCTCGTCCATCATCTTTCTGACCTGATTCGACGGTTCTCGGGTGTGTACTCGAGCGGATCGTCTAGACGAATCTGTCGCGCTTTGGACCTGCAAGCTGC
AAGGGGATGACAAGGAACTGAATGACTAGGTAAACGTGGGAGACTGAAAGGCTAGAGAGAGGGAGAGAGGTGTATCATGCTGCGTAAACGAATCGTCTGC
ATGACTAAATTTTACTTTACCCATGCTAGAAAATGGGGGACAAAAGCTCTATAGTATCCTATCGGATACGCTCTATTCTATCCGTGTGACTCAGCGAAAT
TGTGAGCTCATGCAGCGACTTTCTGCGAGACTTTCTCGATACAAGGACGAGCATAAAGTCCTCACAAGTGAGACCAGAGACACACAGTCTTACTGCACTG
ACGTGTCCAGTTCGATAGTCCACCAGCCGATTTCTTTTCTCTCTCTCTTTCGCAAGACAGAAAATTAGACTGTCCATCCTACTTCAAGACTCAACTGCAA
GGGTAGTTTTTATTAAAACCCAGGCTGCATATGTCCAAACGCCTCGCGAGACGGCTCATCTTCTTTTGAGTTAGCGAGCTGCAGTGCCATAATATTGCGT
TGCGTTACGTAGTGCAGTACTGCTGCTGAGTATCGAATTGTAATACAAGTTTCGGAATCCAACTGAAGCTGTTAAAACAGTGCCAGTGACGAAATGGATA
CTCCGTGAGCCTATTTGTCTTGGTGGTGTCAACATGCGTGGTTGTATGGATTACAGCGGAGAGCAGCATCAAAGCTCTGGGTCCAAACCAGATCCCACCC
CGAGAGGCCTCGGGGTTCAAAAGTACCTTAACTTGAATGCCACGGCCATCACAGAAAGTGTCACTCTAAACTGATTCACTCGCCCAGATTTTAGCCTAGA
GGGCAGAGCCATGCATGTAACCTCCTCTGAGGAGGTAATGAGCTTGGCTCAGCTCACCAAGGACGCTTTTCTCTTCGCAGTTTTGGTCGCGCGTCATCCA
TCAGTGCCGAGACACAACGGCAATTGAGGTTCTGTAATAGAGCGTGCGCTCTATTACAGAACCTCAATTGCCGCTGGTCGACACCACTCATTCCCAGACA
TCCACATTCTGTACCAAGGATCCAAAAAGCATGGCAAAGAATTGAGGAGCAAAAGATCGGACCAGATGGAAGGTGCTGATACCAGTTGGCTCGATGTTCT
GATCTAGTCAGAGTGTACAGCCTAGTCGCACCCCAGAACCCTCTTTATATACAGTAACCAGCCTCTCTATATCGCATAAATCGTGCGGATCCCTGTGGCT
CGTCTCTCCGCTCAGTGCGCCAGACGGCCTGCGCTTCCTCTTTTCCTCGAATTTAGTTGAGTCTCGGGATACTTTAGAGCCTCTCAAGTATGATCCCAAG
CCTCGACAGTCTCCAGTTTGCTCAAACTCGGTGGAACGTACTGTGTGCAAATCCATTTTGATAAATGCACAGCGTTTGTTTGCCAGAACCAACGAAACGA
ACTCGACTCCACGTCTGTTTTCCTAACGGGAGCTGCTTTGGAAAGGCTTTCAACGGTAGGCAACAGGAGGCAATCACAGTTTGCAGGACGTGTCGCTGGC
ACTGTACAGCCCGAACGCTGTAATCAGCACGCCAGTGTTCTCCCATGTGGTGGCGATACACTCGCCCTATGTGTGCCGAGCTCCACTTTTAAACCTTTTT
AAATAGTTATCCCCTTTCAACTAGATAAGATCTGTATTGATCATTTTGCACAGATTTTAAACTGTAGTGCTGCTTCAACCTGTATACCTGTATCTTTTAA
TGATGTAGTGCAATATAATACTGTAAAAACCTACGACAATTTATGTATACGCTCCGTGTCAGCCAGCAATGGTCAGTACACTGCTTTTGCACGTACACAT
CTCCACGATACACATACAAACTGCAGTGTACATGGAGATGGTCTGTAATGGAGAGGGGCCTTTGTAAAGGCGCGCATCTGGCGGCCGATGATGCGCCTCC
TCCTACCCCCTCATGCCTGATGGACTGACTGACTGTCTGCGCTCTTTGAAGCGCGCGCTTTCTCTGCCACGTGCCGTCACCCGTGCACGGACGAGACGGT
CTCCATTGTCCGCCGCCGTCTTCCTTGTCCCCTCTCTCACTTGTGTTTCCAGCGCCGAAAGCACGCAGCACAGAGCTCCGGAAACAAGCTGGCCGCGCGG
AAAGCAACGCCACCGTCCGTCCACTCTTCCCATTCTCCTGCCGCCTGCCTGCCCCCCCCTCCTCCCCGCGGCACTACTGTAGAACGACGCGGTTCGACAC
GCCACCCGAGAGCGTGCCACCATCCATTTTCGTTTTAGAGTCACAGGTTGGGTGTAAGCGA