Description :
Non Conding Region
Location :
Scaffold_1:123786- 126802
Sequence
3016 bases(100 bases per row)
GGGGGTGGAGGGGAGGAGGTTGGTCGTCCGGAAGGTGACAAATTGAAGAGTGAACCGTTGGAGGTGGAACGGCGTCTTCAAGGTGCAGAATCTTAGCCCG
TCGTCTGAGACGTCGACTTACGGGCGGCGTAGCGACTTACCAGATGCTTCAGCATTTTTCAATCCATACAAAGAGAAAGGCAATCGTCGACTTTGGGGGT
GAGGAGACGCCGAGCACGTTGACTTAGCGGGAGGAATGTCGCTTTTTGGTGTGAGGCCGTTTGGAGAGGAGACGTTGCCGCTGATTTATGGTCGGAGTAT
GCTGTGCGGGCCACTGCTTGCAAGCTGCTCCGGACAGATGCAAGGCGGCGAGGAAGCTTTCGCTGCCGGATCGTCATCGGTCTGCGATATGTGGCGCTGA
TTCCAAAGACTCCTAGGGCCCTGGGGAAGACGGTCTTCCGAATGTCCTGCTCTGCCagtccagcaacgccagccGTTTGGCACTCCTGATTTTTGTAGTG
CGAATCAGTTACCGTAACTCCTCGACTGAAGCAATTCGGTGCCAATTCGGTGCCTGGGCGATTGTGGAGCGAACGTTTGGGGGCCGTGCCAGCAACGCCC
GAGCCTTGTCCTTGTGGCgctttgctgctggaggcgggCGAGGCTCATCTGCTTACGCCAACAACGGGGCTCACGACTGCAGCAAACAATCTTCGAGCCC
CGAGAAGAAGCCTGAGAAGCAGAAGATATGTTTGACAGGAATCAGTGGGTTGCCACGAGCGTGGGTTGGCTATCTGCCTGGAAGCGCGTTGCAACTCGTG
CCTATACTGGCGCCAGCGAGGATTCTTCGGCGAGTCTTTCCTCACGCTTGCTTGATGCAGTGCTGTCGGAATCCGGCTGACTGTGCACACGACGGACAAC
GCGCTGACTTATGGGTTGCATGTACcggacgttgaagtggtagGCCAGGTGTCACCTTGGTGttctccgagtcggagcgAGTTGAGCTCCACTGGAGTCA
ACAACAGACCGCACAACCGATAGGCATGCCTGCGACCCGTTCAGCGCTGCAACGCGTTGACTTAGTGCGCGCTCCGGATGCTGAGCGAGTCTAACGCACT
CGTCCGCGTTGCGCTCGTAATCGTTAAGAGTTGTagtcgctggaggaagcCGGCGCGAGGCCACTGGCTGTGGTCGCGCGTCGTGATGCAGGGCCAAGTA
TCGATACCCATTACGCACTCGCAAGCTGCATTCACTTGTTTGTCATGGCAAAAGATGTGGCATCGTCGCTGATACGAATGTTTGGGCTGAAAACTGACTT
CAACTCATCAGTGCGGACAATCAGAATCGCTAGGCGCATCTGAAGTTTCAGCATTTCAATACAGACCAAACCCTCGGCCAGCGATATGAAGCTCGGCTCA
TTTCTAGATGGCATTGGCACCTCTTTTTCTCTCACTTGAGTCTCATCCGGGAGCAATCTCGACAAGATGTGGGGATCAAGAGCGGATCGGCGGGCTTGGA
ATGGTGGGCATTCAGCCATTTGCGTTAGTATACGATCACACTGGGTGCGGCTGATTTGACCTTCTTACAAGCTCCTCTGCAAGTATTGGGCGTTGTTTTC
TCTCCGATCGTAACTTGGAATATCGACGCCTCGAGTCTGTACCAACCAGAGTACTATGGGGCCGAACGAGTGCATTCGCACGGTATGAGATGGCCATTTT
GCGTGCTTAGATACTTTGGAAATGCACGAATTCAAGGCGAGCTGGACGCATGTCGCGAGGGCAGGAGTCGAACGCATACCCACTGAAGATGCTGCTTTCA
AACCTGCTCGAGCTAGAAAACAAAACAAGCGAagaacttcaacttcacgtTTACAAAATACAAGTGTATTTACTTCAACATCCCACATACCAATTGCAAG
TATAAAAGTGACAACCGCGACTGGTACAAGTTCGCTTGGCCCACTGAAGCTGGATGTGTCCTTCGCCCATACatgttggcgttgctgtcaGTTCGTCACG
TGACTGTTAATAGCGGGCTAATGACTCGGGCCGGACACGTAGTGGCGACTGGATTGATTGTGCTCGTGTATTTGCTGCGGTAACTAAGCCGTGTCTGATG
CCGTCGTTGGTGTCTGACGATATCACTGACTCAAGTCAGTGATGTCACCCACTCACACACTGTGGTGTGAGGCCATCCAGCCTCCGCCTTTGGTCTACAC
TGGCGCCAGCGTGTCGTCTTTCCTCTCTGTATACAGAGCGTTGAATTGGTGGGGAAATATTGGCGTTGCCCTAGCAGCTACGTGCCACATCTTGGAATTT
TGAAGTGGAAAGTGTAAGACCACTATCGGACCGaactacagcgacgacaggaaggcaagttgaagccggCTGCGGGCCTGACAACGAACACGCAACCGTG
TGTTGACTTAGTGCTCGCGGGTCTAGCGAGTCTCACGAGGAAGCCGGGGTGAGAGTCTGGCTTTGGCTTCGCGTCGTGACGGCAACGTCAATGCAGTTTA
ATCGTATTGTGAGCTCGTTCTGCCTCTGCCTTGGAGCTCGCACGAACTTGAGGGTTTGAATCAAGTTCTTCGATGTTCGGGTGTCCGACGGGCATCGAAG
AAATTATTGTGCAGACCTCAACCCAAGTGAAGCATCAAGCTTTGCGCTGGTGTCTCCGTCGCTAGTCGCGATGGGTAGCGTAACTTAGTGATACTTCAGA
CCCTAGAGCAGATTGGAGTCGGCGAGGCCATCGTAGGTGTCTCCAATAGTTGAAATCTATTTCTCTAATACAATGCGCCAGGGGGGGGGCTTACGTCCTT
GGTGCGTTCCAGACAAGGTGAATGCTGTCGTCGACAACTCCGATCGAGTCCAACGGCCAATCCGTTTTGCTACCATAATTATCGTGTTTGAATGCACGCA
GCAATTCGCAACCGTCCACGACGAAACTTACCAGCCATTCCATTGAGAGCAAACCCAGTCCACGTTCCTAGATGACATGGTGAACAAACGTACCAAGAGC
AGGCGACGAGCCTCCA