Description :
Non Conding Region
Location :
Scaffold_1:123447- 123976
Sequence
529 bases(100 bases per row)
TCGGCGCGCGCGCGGGGCGTGACCTTCTTGAGCCTGTGGAACTTGGGCGACTTGGGGATCGTCAGGCGCCCGTTCTCCTTGGCCACGCGAGCCAGCCGAC
GCCGCTTGCGCGCCACCTCGCGCGCGGCCGCCAGCTCCTTGTCCTTGCCGGTCAGAACCTTCTGCCTCGAGGCCGCTATCGACGCCTTGGTGGGCTTCAG
CAGGCGGTCCGAGGACGAGATCGCTCGCACTCGCGGCACACGCGGGGGCACACCGCGGTACAGCGCGTCCGGGTCTTCGTCGAACAGCGGGCGCGTCACG
GGCGCCATCTCCACAGCAGCAGCAGCAGCAACGAGCAGCGACCTGCCTTGGTGCCTACAGCTTTTCTTGAACTGTGCTGGCGGGAGAACTGCGGCATACA
AACACCAAGTCAATCAATTCAAAATTCAAATGGCCGATATTAACCAATCGAAATGTTTTGTTTACTTTCTACCAATTAGGAATAGGGACTATTTACGTTG
AAGTGCACATCGTGGTATTGAACGGACGA