Description :
Non Conding Region
Location :
Scaffold_1:123361- 123441
Sequence
80 bases(100 bases per row)
TATGCTAATATAATGTTGGGTGAAAGAATCCACAACCAATAGATAAAGTACTTGCCCCCATGTCGACTGCACACCACAGC