Description :
Non Conding Region
Location :
Scaffold_1:122865- 123063
Sequence
198 bases(100 bases per row)
CGGATGCCGGCGCACATTGCCGGCATCTGCGACGCAGCTGTGAGTCTGCTTGGCTCAACGCCATGGTGGCTGAGGTCGGGGGCGACTGTGTTAGTAGAAA
TAAATGGCATTAAATCATTAGTAGGTCGCTAGGACAGCGAGGACAACACGATCCCAGCCAGCACCAGCCAGCCAGCCAGTCACATATCCTTCATCACT