Description :
Non Conding Region
Location :
Scaffold_1:122741- 123182
Sequence
441 bases(100 bases per row)
CTACAGTAAGTcaggtgttgctgccgcCGTCCCAAATCGACGAATGGTGTCTGTATACGAATATGCAATGAGAAAATGCTGCCCAGCAGTCAAATCTTTG
CTCTTGCCACGTTCATGTCCATGGCGTCTATCTGTCGTAGACATTGTGACTGACGCTGCTAGGCCTATCTTGGCTCAAACCGTTATGCTTCAAAATAAAT
TCGTCAATTGTCCATCTTTACCCTCTATTTACGAAAACATCCATCCTTTCATCAAAACCTCTTCAAAATCCATATTCCTTCTACGTCTGTCTTTGTAAAT
TCTCACAATAGTGACAAATAGTGACACCCATCTCGGCTAGATACGTAATTCTACCTTTTCTTAAACAAAGGGGGGCTAAAGAACACGCCATCCCCAGTCT
CAACGTATCGACGCATCGCCCAAGCTTCTTGAGCGTAGCGA