Description :
Non Conding Region
Location :
Scaffold_1:122390- 123030
Sequence
640 bases(100 bases per row)
TCGGGCGGTAGGGCGAGCGGAAGGCAAATGCGCGAATGGAGCACGCCACGCCCGCCAGGCGCCGGGAGGAAGATACCCGCCAACTGCTTTCAAATCGGAT
CCGATGGTACATGGGTGCACTCCACTTCCAACTGGGTCACAGATGGTCCGTCGCATAAATGGGATCACAAACGAGGCATAGTGAGCGCAAGTGCGCTCCA
GTCGCTTCCTTTTTTGTGGCTCAGAAAATCCGAGCGGCACTGTTCGTATGACTGGATTTGCGCGGATTCAATCCGCAGTTAccaaagctgctgcagccac
ttgGGACAGACTGGCAGTGATCATCAAGCCTCGTCGGGTAAACCAAGAAATCCACGAATTGTCACGCGTTGCTGGGTAGCGTTTGCACGGGGAGCAAGCC
CCTAGAGCGGCGGAAATCCACCGCTCCACtctctgcgtcgtcgtctacGCCTTACAATCAGGAGATCTGGCCTTGGTTTCAGGCTGAGCATGGCGATGCA
CGTTGAAATGCTTTCGCTGCTTGGCAAAACGCACAGCACATCGTGTTCTCTTCCACGAAGGAGAAAGTATTCACTTTATGGTTTTAGGTACTTTAGGTAG
TCTTTACTTACGGTAACGAAGATGGTCGGTCTCGCTTTTT