Description :
Non Conding Region
Location :
scaffold_1:122301- 122935
Sequence
634 bases(100 bases per row)
GTGTCTTGATGTCCCTCTACAACTCAGGGAGGTGCGCGCGAGGTCTGCCAAAGGGGAATGCGGTCGACTTGAGCCAAGAGGGGGAGGATTAGATACCGCA
CTTAACCGGTAAATGGAGCCATGTTGCCAATCAGCAACTGAACTCTCTTAGATTTTGTATCTGTATCCTGATCCAGCAACCACATAGATCGGCCAACGCA
GCTGTTGCAACCGGCTGGGATTGACGGACGGCGCGCGAGAGGATTTGACTACCGAAGCACTAAAGTAAAGGCTATTGTGCTGGCGTCACAGCCAACGTGC
CGCACTACCATGACTGCGTGCCTCCTTAAGACCGCTGTAATTGCAGCGCGTGCCTTCATGTGGTGAAAGTTTCTCACCAAAAGCTTCTCAGCGTAACGCT
ACAAGTTTGCGCTCGTGAACTCATTTTTGAAGGTCGTTTTCTGCAACGGAAATGATTTACCACCAGATAACCGGTTTTAGTAGCCTTATGTAAAGCATAT
CGTGTTGAGAACAGCCTACTTTACCGCATATCATTTTATTACCGATATGATTGCCATTGATTGCGCCCTTTGACCATCACTCTGTCCACGGCGTCTATCA
CTCGGGTACCTACTCCTCCGGTTCACTTCCATTA