Description :
Non Conding Region
Location :
Scaffold_1:122192- 122717
Sequence
525 bases(100 bases per row)
TGGAGACGACATATCTGTGGAAAGAGACCTTCTAAATCTCTTCCACATTTACAACATTTTCAAACCCCCGACACTAGGAGATTGTAGCTGACTTGTTGCT
GACATACATTCAAGTTGCGTGCTACAATGTAGATAGGGTAATTAATATGTTATAGAAGCTACATATGAAAAGGATAGTATTTATTTGCAAGGGTTTTCGT
CCAATATTTTTGTGAGTCTTAACTGTAAATTGATTTTATACGTTAGTAGTATTAATACTGTTTACTATTAATACTACGCAGTAAGAAGTTTGCGGTTAAT
ATTATATATATATATGTATATTGCGCTTTTAACACCCAAATTTGCCCTATTCAAGGGATCGTTGAAATCACCAACTCGAGCAAAGTAGTATAATTGGCTA
AGAAGATCAAAGGTTGATTGTAAGAGAATGAAAACGTTGTTCTAATGTAGTGTCACATTTACCTCTTAAACTTGGTTATGTATTAGATTTCGAAGGGCCG
GCACACAATATCCATGTTTTATTCG