Description :
Non Conding Region
Location :
Scaffold_1:121951- 122457
Sequence
506 bases(100 bases per row)
CCAGCACGGGACAAGAGCTACACGTAGACGCTGTGTCTTTGGTAATAATCAATTTCTGATCGACTAACTATTAGAACACATCCACATCACCTTCTCCTCG
CCGTCAGCTCCCTCAGTTCTTCCCACAATGAGCGATCCTCTCCTCCAGGACCGCCAACTCGCTCGACTTGCTTCGCCGCAGCTCTTGTCCTTGCCCTGCC
CTGTCATCCACGCAGCACGCGACACACGCCCGTCACGCTACCGACTTCCTTCGTCTTCGGCCTTGGAACTCTTGGCACGGCCCTTGACTCTCCTTTCCGA
ACGCTGCAATCTTGAACACCCGAGGCGGATGGATGCGAGACTTTGTCGGTGGGAGACATGATACGCCACTTTACACACGAGTTCGGAGGgCGAACCAACT
ACACCAAATACCAAAACCTCCATCCACAAGCGGCGATGACGACAGTTGTTGTGGGGTCTGGATGCTGTACCTGAGGGCAATGATGGCTTTTGTGATTTTT
TGtACT