Description :
Non Conding Region
Location :
Scaffold_1:121865- 121933
Sequence
68 bases(100 bases per row)
TAAGCGCTCGATGCCACCCACCACCTGTGGACCAGATGCATTTAGTACCACCAGTCTCTTTGTGTTTC