Description :
Non Conding Region
Location :
Scaffold_1:12154- 12263
Sequence
109 bases(100 bases per row)
TGATTCCAGGTGCACACCAGGTGAATGCCACATCGATTGCACACAATAGTACTGATTGACATTCATTGCATTACGTCACTATGCACCATAAAATACAACT
CACTGCCTC