Description :
Non Conding Region
Location :
Scaffold_1:121383- 121487
Sequence
104 bases(100 bases per row)
CAGAAGATGTACCGATTGTAGACCAAACGTAGACTCTGCTTGCACAACTACAATAGATTCAGGCACTTACTTGCACCAAGCCCTTGCCCGGATTCTTCTG
TTGT