Description :
Non Conding Region
Location :
Scaffold_1:121229- 121589
Sequence
360 bases(100 bases per row)
GTGTATAGGTAGAGTGTATCGAGAGGCTGGGACTTGTCGGGAGCTCGTGAGCTATTGGCGAATGACCAGCAAAATACGCTTCCGTTGGCTGCCAGAGACT
CCGTCTTCAAGCTGGATGGTTGGCCAGAGCTCAAGTACCAGCAACAGTCAGTGTGGACCACTCGATAAATAAAATGGTACTTTGTACCATATTTCTCTTC
CATTTCTATTTCTATTTCTGGCAGTTGCCGCAtcatgtggtccacacattTCATTCCTCGAGGTTTTATTGTTTTAATTATCAACGAGGTTTTATGTTTC
GTTTGTGTGGTTTAGCGGGATATTTGGAAATATCCCAGCTAGGTAAACCCAGACTCAATA