Description :
Non Conding Region
Location :
Scaffold_1:121202- 121632
Sequence
430 bases(100 bases per row)
TGGTAGTAGGTTGCGTTTGTGCCGAGGCGCATGGCGCCGGCGTGTGCCGGCGAGTGTGTATCATCATGATTGTGTGAATGAATCGAAAGATCGGATTGAA
TATCCTCTGTCTAAGCGTTATCCGAAAATCGAGAGACTATGCGCTTGTATACTTTTGGGTATACACTTCTCTTGCATTTGTCATACACAATCAAAGTGAG
TTATATCACATTTGAGAGGGATGAAGTCGCGGGCACTATCCACCCATATCTTCATTCGGTGGCAGCAGTCGAAAGATACAAGCAATTTCCAAGTGTAAAC
GTGAATAAAAAAAATAACAGTCGAAAAGAGAGAAAAAAACATCATATTCACACCGAATCATTCGGTTTAGTCGATTTTGGAGACGATCTTGCGTCACGAA
AGGCCGCATATACTTCAAGAACAGGAGACA