Description :
Non Conding Region
Location :
Scaffold_1:121065- 122617
Sequence
1552 bases(100 bases per row)
CGATCGATACCCCGATAGATACCCAGAGCCATGAGTGACATTGCGCAGAGTCCGTAGTGGGCGCGATGACATTATTGTGTGCGCCTGAGCGACCTTATTG
TCGACTTACTTGAGTGCACGCAAGATGAAGGCTTCGTGAATTCTATCCAACTATCTATCCAACTATCTATCCATCTATCTATCTACACTGTACGAGTATC
TCGTATCTCGGTCGTAGACCACTTGGGCACTTGAGAGAGATTCGGAGAGATTCCGTGCATGCCAAGACTCGATTCGGTACTGCACGACATACAAAATGCA
AGCGATACCATGGTGCGAGCCAGTGAGCTAATTGAGCATCGACAATGAATACCGCCTCTTCAATCGTTCGCTCCAGGAGATGGACGACACAGCGTGTCAG
CGGCCGCAGATTCGCTCGACCTTGTGACCGTGCGCCATTTATCTCGGTCACGAGCAGCGTACACAGGCGAGCACTTTACAAGCCATCACAAATCCACGCC
AGCTGCCACTGTGCTTGGCGTGTTACGCAGCTTGAAGCGTCTTGGCTTCGTTGCATGTGACTGCAACTGCGCCAGACCACCAAGTCCTCGCCTTGAGCGC
TTTGACACGTGAGTGAGGAATGGTGGATGCATAAATGGCCAGTGTCGCGGCCATGCACCCGACTACACTGCATCAACCGGACAGACGCAGCGCAGCCGCG
ACCAGACACGCGGTTGGCGCCACGAAGTGACTCACACTCAAACCGGTTGGTATGCAAAATCGTACGTACATACTTTATGTGTGCCAATTTCTCTCAATAT
TTGTATGAGATGTACGTTGTACGATCGGTACCGTACGTACAGAGCCCACATGGTTGCAGTACACACTTGAGGTTGGGATGCGCCAAGCCCTCGATTGGCT
GGTGCCGGTCCCCATAAGTGCGCATGGGCATCCGCGGCGACTTCCACCCACCACCACAAGGTCATCGCGATACCTCTGGCCGCCCATGGAGCTCGATGGC
GCTTCCTTCGCATTCCAGCCGCGCTCGCAACACCATGCTCGGAGACGACGTGTGTTCTGCCCAGATATCTGCGATTGCTACTCGACGGCGGCGATCGCCG
ACTTCTGGGCTGGACACGCATCGTGCCCGGGAATGATGTTGCTAGCGCGGCTGGCACACGCACGGCAACACTAAGAACACTCTTCGTCGTTGCGAGGGCT
TGCGACCTAATGACCTCATTCGCCTCGCCTGCTAATGGCAGTAGCATGGCCCATGGCTGCAGGTGCATGGGCTGCGACCCGGCAGGCTCGTGGGTTGCCG
CGCACAGCAAGCCGCCAGGTCGCAGGAATGATCGGCAACACTTCTGGTCAGCGCAATAATTTGTGCCGCTTCGTATTAAATCCCTTGTATTTTTATTGCA
CTGGAACGCGGGTATCGTATGGTACGCGGCTGCACCACGTGGTTTGGGACATTAAAATAATATTCGCCTCATCACATTAAAAACGGTTGATCCCGATGAA
GTGCGTAATCGCACTTATACGGGCTCCACCAATGAAGGGCAGATGCATTTTG