Description :
Non Conding Region
Location :
Scaffold_1:120970- 124300
Sequence
3330 bases(100 bases per row)
atgcaccacatcatgcaccgcagcctggttacgcgtacgcgcagcctgcttacgtggcgcagcctggcgtagtgatcgctggcggcaagatgaaacatgg
caagtacaaacatggcaagcacaagggccacaagtttaaaggacacaagtacaaaggctacaagggaaaaggcttcaagaagatgggcaagaagatgaag
aagatgttcaagtaggaagtcttcggttttgttccgtccgaacgcttgtacagtgcactgtactgtaccgacttccaagtgttgagtcagctctgttgat
gttgttggaggaaagaggattcgagattgtgatggaaatcggccgccacgtgaacagcttaaactcgtgttgtgcttttggataaccgaaaaaggctagt
gagactccatttgttgttgcttgagttcattgtcttctatcgtctctttttcgattctggcgtcgctctatgcgtgaatggtgcacaagatattgatgca
ctaagtattattatcagtgtacaagaggcctttgatcaagttgaagtgaagcgcaatgccaggcgactgatgttaacagattgctcctttatgcaccact
ctacatgtattatcccttgtattgtaggcatcatggagttagaagcactgtagttcccatggatcagattcattctcgactccaaattgctgagtcacga
acaaatttacatgtacatgaatcgacagctcaagtacttgcagcaaaactgcaacgcagacgaatgagcaatgcacaactcgactgtcaataactggtcc
agttatgttcgtatgggtgagattctgtcacttgacagtgtcaactgatgaagttcgagatcatgaactcggtcttcccctgtgtcatacagcaagggca
taatctggttgtgtgagtgtgggcaaagtttttgcttttgcacttaaggcagatctctgttgaagttgtctcacatctgattggctctgaatcaattgtc
gaagttgcaggttacctggcgtcattcctcaatttgccaagcctcgtagcaaccaacaaggaaacgccacaagaaccatgttcggccgcccgcactcgcc
cccgcacagcccaccgcaccaccatcactgtcctcctcctggccaccaccacagtccacccccaccgcaccaccaaggacctccaccacaccaccacagt
ccaccgcctcctgaccatcgtcacggacccccgccgcaccaccacatcccacccccaccggatcaccgcggaccccctcccccgcgtggttggtaaaaat
tcagggcagaacagtccaaagaaaaatggcgaacgcgttgagcatgagtaggcaactgcaccaagcaccgctttgccaccataaaatatactgcgttatc
tgcaaccaacctctatttgtcatgtgaagttgcattcttcttccattacttaaaaagcgtcactggtgccatcgcgctctcgttagatcaggtctagatc
aggttggcgcagagaagtgtcaggcctggatgtgcattgaagctgcaacgtcgcatgacccttttcgctcgcaatgctgagtatcgcagcaaagatcctc
ttgctgcatcatttacaaagtctgcaacacgtttcgccaaaactcgtacaagaaactgtaggcgcggttaactttttttgtgatcgtatacgtaacatgc
atcgcgggtttcctggttcttcgcgcggaagacactcgctaccacccccgatggcgtactcgtccccggcgccgccgctgtacggatatgggcccggtcc
aggctgtcctcctccatggccgttttcgccaccacaccatcactatcatggcccaccgccccctccccgtagaactccgggggactccctcggagttcta
cgagagactgccgtatggcgacacccctccacatcactacatgtaccggtaccaccacccttccccgaggtggtaaatatgtgcatggcggccgcaattg
ttagttcactactattatatttttccgggcttgtattgcaatatacttcttgacgttctaacattcaattcaaaggtgcgagtcaactatattatcagct
cctcgataaaactaccccgtacatacacatctagatacctgtgggtggatcgcatcgagagaatttcctgtgaaggagtttaccgacgcttgaagaatca
tttggtgtgccaagacgatcgtttacctacgttttgaggtggatttccttgcttgataatcgtcatgtctcaatttgagactctcaaaatcgcgcagctt
cttcaagagctcacaactcaattttccacatccagtccaagtccaagtgcacagcacaaatgttcccctttctaggatcgccccgacaccatcaccacca
ctatggcccgcctccccccgtatatgtggcaccctcgactgttgtgtacgcggcaccacccccgcctccaccagtagtgtacgctgtaccccctcctccc
ccgcctcctgtggtctatgaagtccctccacccgtgttctacgaagtcgccccaccgccgccatatttccatcaccaccaccatcaccacggctggtgat
caatatcgctggaataaacaacaacagaatcataataaattcctgtaaaatgccgtatttctaagtgttgtgttcatgaacttgacaaaactccaggtaa
acaaacaagcacgtgctgagtggtgtcgcacaacacgatccagctccttttcaccctgggtcaaaagaaaacacgactaccaaagtacaaatgaacaccc
cgcctcgcggaaacgaccatcgatacccggaacttccggtcacctcgtttccccgatctgcgcgatttatcccgcctcacagacaacttgtttcacgaac
cacagcatcacctggatcgcgcccgcattggcgttacgtgccccgtcgtattgtcgcgagtcgccgcttggacgggacggttaacgttgatgttttgaaa
gagaacggaacggaggaacacttcgaaagcttagacacaagttaaaatgcaagcaaagcaaatatacttgtggggtccaaggcaaattcacgactaaact
cctaaccaaccttcctcttcagtgtcgtccttcgtccttcgtcctctttcgtcctccttttgtccttctcgatcccgctctttccagcccaggtacctca
caccccctctgtgagcatacccaccgtcccgtagcactgagccacgcgctgcatcacgactcccgtcctcgtcatctcctttgacgcaatcctgcgcagg
tgcgtgagcgctggcgccacgcgcagacct