Description :
Non Conding Region
Location :
Scaffold_1:120789- 120912
Sequence
123 bases(100 bases per row)
CAGACAGATACACTCAGCAAGCGACAAGGGACAAGATGACTTTTGTAGGAGATGATTTTATAAAGGTTTTGCTTAGATACTCTATGGATTGAAAATGGTC
TTGGCGACACTGACTGTCTACTT