Description :
Non Conding Region
Location :
Scaffold_1:120778- 120802
Sequence
24 bases(100 bases per row)
GCGTACGTCTCGACCCCGGGGCTT