Description :
Non Conding Region
Location :
Scaffold_1:120548- 123720
Sequence
3172 bases(100 bases per row)
GCGCTGATTGGGAAAGCGGCGGACCAGAGTGCACTCAGCTACAGCAATGAAGGGTGTCGACAAACCTTCGACATGAAGCAGCAGCATGCAGTTATTGATC
TACTGCGGCTAATAGCTAAGTTCCACTCACTGAATAAAACCTGTATTGAGCTGAATCTTGCTTCGAGTGCGTGATATGCTGACTGAGCTGAACCCTCGCC
ATTGCCAACTTCATTAAGCCCGCCTCTGATCTTTCAAGAGACAGGTGCGCCTATGCTACCTGTTTAGGGAAGCGATTCAAGCAGTGGCGATCACGGTGGG
CGGACTGGAGCCCCAATGATTCTCCAGCACTGTACAAATGTCAATCGCCAATAGTAGCACAATACAAGCCACCAGTACGCTTACATTCATCACATCGAGC
TCCTTTCGCACCAGTAGCCGCTTGGACTCGGGTAGGATATACTTGGACAACGAAGACACATAGCCCCCCCCCCTACCAAATTTTGGTCCCTCCCAAAGCC
AGCACCGGGTCCCCGAGGAGTAAACAGCGAGAAGTTTGTCACACTCCGGGAATAAGTAAAATAATGTCCCCATCAAGTGCGAGACCGATCTCGACGCCCC
TGGAACATTGAAACGTCAGCAAAAACCCAGTCTACAAAGTCCCGGTGTACTCGGTGTAGTTAGAGATCTTCGGATACAGCCCAGTCATCAAATTTCAGGA
TGCCAGGACAATTGCGCTGTTCGTAGCATCGAACTGGTCGGCATATGCCTCCAAAATGCCGTAGAATGTGCTATCCTATAGAGGACGGCCCATCGACACC
AACGACGTCAACGCTCCTACGTCATTATCTTGAGTCACAACGAACTTGTACGCCGAAGCAACCAGGACTGCAAAAATTCCCCTGTACGATGATATTTGTG
GATACGCTTGTTTGCCCGAACGAGGGCGAAGCGAAATACTTCCGCAAAATTTACTTTGCGAGGACCGGTGAAATGACTTCACTCGCCGAGTCAAGCGCAA
AATTCACCAACTGGGCGGCGTCATGAGTCTCAGTCGACTTGTTCACAATAAACTTCTTATCTAAACCTCCAGCGATATCTGACAATTTATTTTCTACTGA
TCCATCAGCTCCGTCTTTTGTAGATTCTTTAATCCACTCGTCACCAACAGATGACCAATTTTCGATAGCGTAGCTATAGTTTGCCTCCAACCGGAGACTT
AAGCGGTATGAATTTGTCCTTGAACCGAACAGCCACAACATTCTAAGCTCCTCGCGTTGCTGTGCTTCGTCTGCCAGCTGAAACAACGTAAGAACTGTCG
TTTGCGCCCCTGCGGATGTTTGAGATAATGCAACATAAGGTTGCATTATCGGTTATAGAGCCATGTGAAACAACAGCAATGACAGTTCTACAGCAATTAT
TTTACAGCATAGCAGCGCAAACTCCGGTTCATTAGAGCTCAGAGCATGCTTTCGGCGATAAGCTAACCAGGCAGCAGCACTAATAAAGAGGGGTGATCAG
TTAATCAATGTAATCTGCGAAGAATCGACCGTATCTGAGCAGCAAGCGAGCAGGGTCGTCGTCGTAACGGCTAAGTTAGTTTACACAAGTGACTGTCATT
TCTACGATACGATATCTACATGTACATTTCGGATGCCACAGCAGCAGCAATGATAAACCGTCGTTGAGTAAACAAAATTATCGCTATTGATTAATGATAG
TGGGTGCAGACTGTTTGTTGCGAGCCGATTTCGAAGTGAGGAGAGCTAAACGGCGTGGAAGTCAGTATAGCAATTCTACAAAATCAAGTTGCAGGCGTCA
CAATTGGACATATAGCCCCGATAACCCGAGAAAAATAAACAAATTATACATTCAACTGAACTGAAGTTCAGTCTGGCAGCTTGAAGCTGTGCAAGTATGC
AGCATGAATATCTGTAGTGTGAGTTCATGTAGATCCGCCACGGCAGATCGAGCAGCGTAAGCGACCCAGCAATTGGACGCATGGTACTTCACAATACAAA
AATTAGAGCATGTGCTAAAATTCAAGAACTTCTTCACGCAACGCTCTTGTACAGCTACTACATAGTACACTAGTAGTAAATAAAGTTTTCTACTCTACAG
GTTTTGGGATACAGTAATAAAAAGCGACCGAACTGCGAACACCGCGGGCCAAAGCCCGCAAACCAGTATTTGAAATAATCGGCGGGAACCCGGGTACCCA
TCGGGACCCCGGTTCCCCCAAAACTACCGGTACACATGTATGAGCAAATGTATTGAAGTGTTGGTCTATGACCTACATAGAACGCAGCTAAAGCTCAGTA
GGGGAACGGAAGGTTAATTCACCTTCGCCCTCGTCCTGTGTCTCTCCACGAAAATCCAGACGCTTGCCTTGTGCAGCGGTACAGTGCTTCCCGGTCTTAT
CGCTGTCCTCCTGCTCATGAAAGATAAACTTGGACATGGTAAGGTATGTTATTTGGGTCTATTCAGTACCGGTGGCATATTTTGAGGGTAGTCCTTCATC
GACAGCACTTAGAGCATCTCCAGCGGTGGGTCTTATCCTAAGACGTAACAGGGTCTTTGAGACCACAATTTTACAGTTGAGACCCGCGCAGACCGACTTA
CTTCCAGCGGGCTAAAGCGAGTCTTATAAGTCCATTCCCGCATGTGAAAATTGCATTCAGTCTTGGTGCAATCTTTTAAATACGGCGACTCTTCAGTTTT
GTATGGGTGGCATTAAGATTGTGGTCTTATTTTAAGACCCGAAAGCCAATCTATAGGTCCCGGTGAAGTTAAAACCTGCAATAGGACCTTCTGGTGGAAG
CCTTAAATCTCGGCCAAGTCTTAACAGCGTTACTTTTAGGATAAAACCGTGTTTGAGACCAACCGCTGGAGATGCTCTTAGGTATGAGGGTTTAACTTGA
CCAATATGGAGACCAAAAATAAAATAAATAATTCGCGATTTGGTCGGTATCATTTGCGGGAACCCGGGTTCCCGCCAATTGTTTCATTTGTTATTCGATG
AGATCGATGAGATTTGAAATGATGGTATATGAAATATCTGATTGATATCGCAATTTTCTACCTAAAATAATATTGAATATTGTGCTTTGATACCCACATA
TCAAAGCGTCGTACTTACAGGGAGGAATCCAAGTCATTTCCACTTTTCGTGACTCTTCACCAGATTAGGCGA